Database of Genetic FH Variants
Search by gene, c-position, p-position, NM number, or reference genome, or view the complete table by year. The archive through 2016 is in the second tab.
Data 2019
| MUTATION | LOCATION | AA. | PROT EFFECT | ALIAS | c-position. | Codon before | Codon after | Functional LDLR class | Country | PATIENT region | Freq | Additional info | REF |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| p.Thr62Met (T41M) | exon 2 | 60 (old: 41) | threonine (Thr or T) replaced by methionine (Met or M) | - | 185 | ACG | ATG | 2B; delayed transport of receptor to cell surface | Netherlands, Spain, Poland, Italy, Portugal | Kenya, Africa; Indonesia, Dutch, Iran, Kuwait | 9 patients identified (status 10-08-2021) | One patient identified on March 29, 2005.One patient identified on March 29, 2005.On June 27, 2005 we found that this patient had a second mutation: G361V. A second index case of Indonesian ancestry was identified on June 22, 2012. A third index case of Dutch origin was identified on Dec. 10, 2013 | p.(Asp47Asn) and p.(Thr62Met): non deleterious LDL receptor missense variants functionally characterized in vitro. Benit…p.(Asp47Asn) and p.(Thr62Met): non deleterious LDL receptor missense variants functionally characterized in vitro. Benito-Vicente A et al. Sci Rep. 2018;8(1):16614:The genetic spectrum of familial hypercholesterolemia in south-eastern Poland. Sharifi M et al. Metabolism. 2016;65(3):48-53. Familial hypercholesterolemia: Molecular characterization of possible cases from the Azores Islands (Portugal). Cymbron T et al. Meta Gene. 2014;2:638-465. Systematic cell-based phenotyping of missense alleles empowers rare variant association studies: a case for LDLR and myocardial infarction. Thormaehlen AS et al. PLoS Genet. 2015;11(2):e1004855. Impact of low-density lipoprotein receptor mutational class on carotid atherosclerosis in patients with familial hypercholesterolemia. Junyent M et al. Atherosclerosis. 2010 Feb;208(2):437-41. The type of LDLR gene mutation predicts cardiovascular risk in children with familial hypercholesterolemia. Guardamagna O et al. J Pediatr. 2009;155(2):199-204. Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JD , Kastelein JJP. et al. Hum Mutat. 2005; 26: 550-556. Genetic diagnosis of familial hypercholesterolemia using a DNA-array based platform. Alonso R, Defesche JC, Tejedor D et al. Clin Biochem. 2009;42(9):899-903. The type of LDLR gene mutation predicts cardiovascular risk in children with familial hypercholesterolemia. Guardamagna O et al. J Pediatr. 2009;155(2):199-204. |
| c.817+1G>T | intron 5 | NA | 3'-splice donor signal deleted | - | 817+1 | G | T | 1: null-allele | Malaysia, The Netherlands | Malay, Dutch | 8 patients identified (status Nov. 2019) | The haplotypes in the Malay and Dutch patients are identical.This mutation is linked to: c.1060+10 g>c in intron 7, 1358…The haplotypes in the Malay and Dutch patients are identical.This mutation is linked to: c.1060+10 g>c in intron 7, 1358+56 c>t in intron 9, P518P and C1617>T in exon 11.In the Czech Republic the c.817+1G>A variant is known and in Iraq the c.817+5G>C variant | not described in literature |
| c.-187C>G | promoter | NA | reduced or no transcription of the LDL-receptor gene and less or no LDL-receptor protein | - | -187 | C | G | 1: null allele; promoter not functional; this allele is not transcribed | The Netherlands | Dutch | rare, 5 cases identied (status June 2019) | Mutation characterized on May 9, 2005. This mutation is in repeat 1 of the LDL-receptor promoter. Repeat 1 is a conserve…Mutation characterized on May 9, 2005. This mutation is in repeat 1 of the LDL-receptor promoter. Repeat 1 is a conserved sequence of 16 nucleotides and is needed for binding transcription-factor Sp1. Sp1 is needed for transcription of the gene. | not described in literature |
| c.-191 C>T | promoter | NA | reduced or no transcription of the LDL-receptor gene and less or no LDL-receptor protein | - | -191 | C | T | 1: null allele; promoter not functional; this allele is not transcribed | The Netherlands | Dutch | rare: one family in the Netherlands. Index case identified on 17-02-2005 | This mutation is in repeat 1 of the LDL-receptor promoter.This mutation is in repeat 1 of the LDL-receptor promoter.Repeat 1 is a conserved sequence of 16 nucleotides and is needed for binding transcription-factor Sp1. Sp1 is needed for transcription of the gene. | not described in literature |
| c.-188 C>T | promoter | NA | reduced or no transcription of the LDL-receptor gene and less or no LDL-receptor protein | - | -188 | C | T | 1: null allele; promoter not functional; this allele is not transcribed | The Netherlands | Dutch | rare: 8 patients (3 families) in the Netherlands (May 2012) | This mutation is in repeat 1 of the LDL-receptor promoter. Repeat 1 is a conserved sequence of 16 nucleotides and is nee…This mutation is in repeat 1 of the LDL-receptor promoter. Repeat 1 is a conserved sequence of 16 nucleotides and is needed for binding transcription-factor Sp1. Sp1 is needed for transcription of the gene. | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. |
| c.-139C>A | promoter | NA | reduced or no transcription of the LDL-receptor gene and less or no LDL-receptor protein | - | -139 (or -46) | C | A | 1: null allele; promoter not functional; this allele is not transcribed | The Netherlands | Dutch | 15 patients in the Netherlands (status 12-01-2024) | Depending on the numbering system, this mutation can be referred to as prom-46. At the same position the -139 C to G is also known. The mutation has occurred in the Sp1 binding site | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. |
| c.-98 C>T | promoter | NA | reduced or no transcription of the LDL-receptor gene and less or no LDL-receptor protein | - | -98 (-5) | C | T | 1: null allele; promoter not functional; this allele is not transcribed | The Netherlands | Dutch | rare, first found in May 2003 | Depending on the numbering system, this mutation can be referred to as prom-5. | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| c.-193_-187delinsTG | promoter | NA | reduced or no transcription of the LDL-receptor gene and less or no LDL-receptor protein | - | -193 to -187 | - | - | 1:null allele; this allele is not transcribed because of the disrupted promoter | The Netherlands | Dutch | 3 families, 16 carriers identified (June 2015) | Comparable to FH-Pedi in which CCC (-191 to -189)is deleted.Comparable to FH-Pedi in which CCC (-191 to -189)is deleted.This mutation is in repeat 1 of the LDL-receptor promoter. Repeat 1 is a conserved sequence of 16 nucleotides and is needed for binding transcription-factor Sp1. Sp1 is needed for transcription of the gene. | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. |
| p.Met1Val (M-21V ) | Exon 1 | 1 (old: minus 21) | Methionine (M) to Valine (V) | - | 1 | ATG | GTG | 1:null allele; no protein synthesized from this allele | The Netherlands, Germany | Dutch | 70 patients in the Netherlands (status 13-05-2024) | Translation initiation signal is deleted. No mRNA is produced. On the same position the variants p.Met1Ile, p.Met1Leu and p.Met1Thr are also known. | The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW et al. Hum Genet 2001; 109: 602-615…The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW et al. Hum Genet 2001; 109: 602-615.Identification of recurrent and novel mutations in the LDL receptor gene in German patients with familial hypercholesterolemia. Nauck MS. et al. Hum Mutat. 2001;18(2):165-166. A novel mutation M-21V in exon 1 of the low density lipoprotein receptor gene causing familial hypercholesterolemia. Lombardi P et al. Clin Genet. 1997; 51: 430-431. Two novel point mutations causing receptor-negative familial hypercholesterolemia in a South African Indian homozygote. Langenhoven E et al. Atherosclerosis 1996;125(1):111-119. |
| p.Met1Leu (M-21L) | Exon 1 | 1 (old: minus 21) | Methionine (Met or M) to Leucine (Leu or L) | - | 1 | ATG | CTG | 1:null allele; no protein synthesized from this allele | The Netherlands, South Africa, Spain, Portugal, UK, Japan | Surinam | rare: 4 familes from Surinam with 35 affected family members in total (status 21-03-2024) | Translation initiation signal is deleted. No mRNA is produced. On the same position the variants p.Met1Val, p.Met1Ile and p.Met1Thr are also known. | The use of next-generation sequencing in clinical diagnosis of familial hypercholesterolemia. Vandrovcova J et al. Genet…The use of next-generation sequencing in clinical diagnosis of familial hypercholesterolemia. Vandrovcova J et al. Genet Med. 2013;15(12):948-957.Molecular basis of autosomal dominant hypercholesterolemia: assessment in a large cohort of hypercholesterolemic children. Van der Graaf A et al. Circulation. 2011;123(11):1167-1173. Update of Japanese common LDLR gene mutations and their phenotypes: Mild type mutation L547V might predominate in the Japanese population. Yasuko Miyake Y et al. Atherosclerosis 2009;203:153-160. Familial hypercholesterolaemia in Portugal. M. Bourbon et al. Atherosclerosis 2008; 196: 633-642. Update and analysis of the University College London low density lipoprotein receptor familial hypercholesterolemia database. Leigh SE et al. Ann Hum Genet. 2008;72:485-498. Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I et al. Atherosclerosis. 2007;194(1):102-111. Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW et al. Hum Mutat. 2005; 26: 550-556. Molecular genetics of familial hypercholesterolemia in Spain: ten novel LDLR mutations and population analysis. Garcia-Garcia AB et al. Hum Mutat 2001;18:458–459. Two novel point mutations causing receptor-negative familial hypercholesterolemia in a South African Indian homozygote. Langenhoven E et al. Atherosclerosis. 1996;125: 111-119. Disulfide bridges of a cysteine-rich repeat of the LDL receptor ligand-binding domain. Bieri S et al. Biochemistry. 1995;34(40):13059-13065. Three-dimensional structure of a cysteine-rich repeat from the low-density lipoprotein receptor. Daly NL et al. Proc Natl Acad Sci U S A. 1995 Jul 3;92(14):6334-6338. Structures and functions of multiligand lipoprotein receptors: macrophage scavenger receptors and LDL receptor-related protein (LRP). Krieger M, Herz J. Annu Rev Biochem. 1994;63:601-637. |
| p.Gly2Arg (G-20R) | Exon 1 | 2 (old: minus 20) | Glycine (G) to Arginine (R) | - | 4 | GGG | AGG | 2A: blocked transport of native receptor protein to ER for folding | The Netherlands, Brazil | Dutch | 7 carriers known in the Netherlands (December 2014) | The codon change GGG to CGG leads to the same mutation. Change in signal peptide, receptor cannot reach endoplasmic reticulum (ER) | Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, d…Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, de Souza Silva PR, Turolla L, Gagliardi AC, Marsiglia JD, Chacra AP, Miname MH, Rocha VZ, Filho WS, Krieger JE, Pereira AC. Atherosclerosis. 2014;238(1):101-107.Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. Molecular basis of familial hypercholesterolemia in Brazil: Identification of seven novel LDLR gene mutations. Salazar LA, Hirata MH, Cavalli SA, Nakandakare ER, Forti N, Diament J, Giannini SD, Bertolami MC, Hirata RD. Hum Mutat 2002;19:462–463. |
| p.Trp10Arg (W-12R) | Exon 1 | 10 (old: minus 12) | Tryptophan (Trp or W) to Arginine (Arg or R) | Enna | 28 | TGG | CGG | 2A: blocked transport of native receptor protein to ER for folding | The Netherlands, Italy, South Africa, Brazil | Dutch | 27 carriers known in the Netherlands (June 2017) | Change in signal peptide, receptor cannot reach endoplasmic reticulum (ER) | Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, d…Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, de Souza Silva PR, Turolla L, Gagliardi AC, Marsiglia JD, Chacra AP, Miname MH, Rocha VZ, Filho WS, Krieger JE, Pereira AC. Atherosclerosis. 2014;238(1):101-107.Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. Founder mutations in the LDL receptor gene contribute significantly to the familial hypercholesterolemia phenotype in the indigenous South African population of mixed ancestry. Loubser O, Marais AD, Kotze MJ, Godenir N, Thiart R, Scholtz CL, de Villiers JN, Hillermann R, Firth JC, Weich HF, Maritz F, Jones S, van der Westhuyzen DR. Clin Genet. 1999;55:340-345. A de novo point mutation of the low-density lipoprotein receptor gene in an Italian subject with primary hypercholesterolemia. Cassanelli S, Bertolini S, Rolleri M, De Stefano F, Casarino L, Elicio N, Naselli A, Calandra S.Clin Genet 1998;53:391-395. |
| p.Gly20Arg (G-2R) | Exon 1 | 20 (old: minus 2) | Glycine (Gly orG) to Arginine (Arg or R) | - | 58 | GGG | AGG | 2A: blocked transport of native receptor protein to ER for folding | The Netherlands, New Zealand, Poland, Czech Republic | Dutch, Middle-East | 66 patients in the Netherlands (Aug. 2018) | Change in signal peptide, precursor receptor can not reach endoplasmic reticulum (ER) | Variability in assigning pathogenicity to incidental findings: insights from LDLR sequence linked to the electronic heal…Variability in assigning pathogenicity to incidental findings: insights from LDLR sequence linked to the electronic health record in 1013 individuals. Safarova MS et al. Eur J Hum Genet. 2017;25(4):410-415.Familial hypercholesterolemia mutations in Petrozavodsk: no similarity to St. Petersburg mutation spectrum. Komarova TY et al.BMC Med Genet. 2013;27;14:128. Spectrum of mutations and phenotypic expression in patients with autosomal dominant hypercholesterolemia identified in Italy. Bertolini S et al. Atherosclerosis. 2013;Apr;227(2):342-348. An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskov, Lenka Kopeckov, Eva Jansov et al. Atherosclerosis 2011;216:139-145. Molecular characterization of Polish patients with familial hypercholesterolemia: novel and recurrent LDLR mutations. Chmara M et al. J Appl Genet. 2010;51(1):95-106. Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie, AD, Scott, RS, George, PM. Atherosclerosis Supplements 2004;5:13-15. Molecular characterization of Polish patients with familial hypercholesterolemia: novel and recurrent LDLR mutations. M. Chmara, B. Wasag, M. Zuk, J. Kubalska, A. Wgrzyn, M. Bednarska-Makaruk, E. Pronicka, H. Wehr, J.C. Defesche, A. Rynkiewicz, J. Limon. J Appl Genet 51(1); 2010:95-106. |
| c.68-5_68-2del | Intron 1 | NA | 5'-splice acceptor signal deleted | - | 68-5 to 68-2 | - | - | 1:null allele; no protein synthesized from this allel | The Netherlands | Dutch | rare: 1 patient in the Netherlands | - | The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. |
| p.Phe32Cys (F11C) | Exon 2 | 32 (old: 11) | Phenylalanine (Phe or F) to Cysteine (Cys or C) | - | 95 | TTC | TGC | 2B; delayed transport of receptor to cell surface | The Netherlands | Dutch | rare; 19 patients identified (status 09-03-2023) | - | The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. |
| p.Gln33* (Q12X ) | Exon 2 | 33 (old:12) | Glutamine (Q or Gln) to Stop (X or *) | Milano-4/Turkey | 97 | CAG | TAG | 1:null allele; no protein synthesized from this allele | The Netherlands, Italy, Greece, Turkey, France, Spain, Russia, UK | Greece, French, Turkish | rare: 1 Greek family in the Netherlands with 3 affected family members and 2 French index cases identfied during the cou…rare: 1 Greek family in the Netherlands with 3 affected family members and 2 French index cases identfied during the course of a clinical trial. One homozygous patient and one heterozygous index case, both from Turkey (status 05-06-2023). | Found in a patient that is also carrier of the V805I mutation. | Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor…Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I, Toledo-Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Atherosclerosis. 2007;194(1):102-111.Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. Familial hypercholesterolemia in St-Petersburg: the known and novel mutations found in the low density lipoprotein receptor gene in Russia. Zakharova FM, Damgaard D, Mandelshtam MY, Golubkov VI, Nissen PH, Nilsen GG, Stenderup A, Lipovetsky BM, Konstantinov VO, Denisenko AD, Vasilyev VB, Faergeman O. BMC Med Genet. 2005;6 :6 Molecular characterization of familial hypercholesterolemia in Spain: identification of 39 novel and 77 recurrent mutations in LDLR. Mozas P, Castillo S, Tejedor D, Reyes G, Alonso R, Franco M, Saenz P, Fuentes F, Almagro F, Mata P, Pocovi M. Hum Mutat 2004;24:187. Analysis of LDL receptor gene mutations in Italian patients with homozygous familial hypercholesterolemia. Bertolini S, Cassanelli S, Garuti R, Ghisellini M, Simone ML, Rolleri M, Masturzo P, Calandra S. Arterioscler Thromb Vasc Biol 1999;19: 408-418. Screening for new mutations in the LDL-receptor gene in seven French familial hypercholesterolemia families by the single strand conformation polymorphism method. N Loux, B Saint Jore, G Collod, et al. Hum Mutat 1992; 1: 325-332. |
| p.Asp36Glu (D15E) | Exon 2 | 36 (old: 15) | Aspartic Acid (Asp or D) to Glutamic Acid (glu or E) | - | 108 | TGG | TAG | this variant has been shown to be benign | The Netherlands | Dutch | 34 patients identified (July 2005) | - | The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615.Functionality of Sequence Variants in the Genes Coding for the Low-Density Lipoprotein Receptor and Apolipoprotein B in Individuals With Inherited Hypercholesterolemia. Huijgen R1, Kindt I, Fouchier SW, Defesche JC, Hutten BA, Kastelein JJP, Vissers MN. Hum Mutat. 2010;31(6):752-760. |
| p.Trp44* (W23X) | Exon 2 | 44 (old: 23) | Tryptophan (W or Trp) to Stop (X or *) | Cincinnati-5 | 131 | TGG | TAG | 1:null allele; no protein synthesized from this allele | The Netherlands, Belgium, Germany, Denmark, Norway, Spain, USA, New Zealand, Japan, Czech Republic | Dutch | frequent; 6.2% of all mutations in the Netherlands. In total 1138 carriers (status 06-05-2024). | More frequent near the Wadden coast, Northeast region.More frequent near the Wadden coast, Northeast region.In Japan the 132G>A variant (TGG to TGA, also known as FH-Nanao), which also results in p.Trp44*, is known. Interestingly, a small duplication of nucleotides AAGT after position c.130 results in the same protein variant p.Trp44*. This rare variant was found in our laboratory on 09-08-2017 in a young girl from Poland. | An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lu…An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskov, Lenka Kopeckov, Eva Jansov et al. Atherosclerosis 2011;216:139-145.Mutations in Japanese subjects with primary hyperlipidemia. Results from the Research Committee of the Ministry of Health and Welfare of Japan since 1996 -. Maruyama T, Yamashita S, Matsuzawa Y et al. J Atheroscler and Thromb. 2004;11(3):131-145. Molecular genetic analysis of familial hypercholesterolemia: spectrum and regional difference of LDL receptor gene mutations in Japanese population. Yu W, nohara A, Higashikata T, Lu H, Inazu A, Mabuchi H. Atherosclerosis 2002;165:335-342. The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands.Lombardi MPR, Redeker EJG, Defesche JC, Kamerling SWA, Trip MD, Mannens MMAM, Havekes LM, Kastelein JJP. Clin.Genet. 2000; 57:116-124. Spectrum of LDL-receptor gene mutations in Denmark: implications for molecular diagnostic strategy in heterozygous familial hypercholesterolemia. Jensen HK, Jensen LG, Meinertz H, Hansen PS, Gregersen N, Faergeman O. Atherosclerosis 1999; 146: 337-344. Molecular genetics of familial hypercholesterolaemia in Norway. Leren TP, Tonstad S, Gundersen KE, Bakken KS, Rodningen OK, Sundvold H, Ose L, Berg K. J Intern Med 1997; 241: 185-194. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat 1992; 1: 445-466. Laurie, A. D., Scott, R. S., George, P. M. 2004. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Atherosclerosis Supplements 5: 13-15 |
| p.Ala50Ser (A29S) | Exon 2 | 50 (old: 29) | Alanine (Ala or A) to Serine (Ser or S) | - | 148 | GCT | TCC | this variant is benign | The Netherlands, Germany, Denmark, Norway, Spain, UK, Poland | Dutch | frequent | This mutation has no influence on the activity of the LDL-receptor protein.This mutation has no influence on the activity of the LDL-receptor protein.Is often found in combination with other FUNCTIONAL mutations like: R3500Q (APOB) or 2204ins13 (LDLR In South Africa and Austria the A29T variant is reported | An alanine29-serine variant in exon 2 of the low density lipoprotein receptor gene: no association with hypercholesterol…An alanine29-serine variant in exon 2 of the low density lipoprotein receptor gene: no association with hypercholesterolemia. Jensen HK et al. Clin Genet. 1994;46(2):214-215.Mutation analysis in 46 German families with familial hypercholesterolemia: identification of 8 new mutations. Mutations in brief no. 226. Online. Ebhardt M et al. Hum Mutat. 1999;13(3):257. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP et al. Clin Genet. 2000;57(2):116-124. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001;109(6):602-615. Application of molecular genetics for diagnosing familial hypercholesterolemia in Norway: results from a family-based screening program. Leren TP et al.Semin Vasc Med. 2004;4(1):75-85. Multiplex ligation-dependent probe amplification of LDLR enhances molecular diagnosis of familial hypercholesterolemia. Wang J et al. J Lipid Res. 2005;46(2):366-372. Effect of low-density lipoprotein receptor mutation on lipoproteins and cardiovascular disease risk: a parent-offspring study. Koeijvoets KC et al. Atherosclerosis. 2005;180(1):93-99. Molecular genetic analysis of 1053 Danish individuals with clinical signs of familial hypercholesterolemia. Brusgaard K. et al. Clin Genet. 2006;69(3):277-283. Silent exonic mutations in the low-density lipoprotein receptor gene that cause familial hypercholesterolemia by affecting mRNA splicing. Defesche JC et al. Clin Genet. 2008;73(6):573-578. The ClinSeq Project: Piloting Large-Scale Genome Sequencing for Research in Genomic Medicine. Biesecker LG et al. Genome Res. 2009;19(9):1665-1674. Molecular characterization of Polish patients with familial hypercholesterolemia: novel and recurrent LDLR mutations. Chmara M et al. J Appl Genet. 2010;51(1):95-106. Impact of low-density lipoprotein receptor mutational class on carotid atherosclerosis in patients with familial hypercholesterolemia. Junyent M et al. Atherosclerosis. 2010;208(2):437-441. Haplotype analyses, mechanism and evolution of common double mutants in the human LDL receptor gene. Tejedor MT et al. Mol Genet Genomics. 2010;283(6):565-574. Low prevalence of mutations in known loci for autosomal dominant hypercholesterolemia in a multiethnic patient cohort. Ahmad Z et al. Circ Cardiovasc Genet. 2012;5(6):666-675. Pooled DNA resequencing of 68 myocardial infarction candidate genes in French canadians. Beaudoin M et al. Circ Cardiovasc Genet. 2012;1;5(5):547-554. Whole-exome sequencing identifies rare and low-frequency coding variants associated with LDL cholesterol. Lange LA et al. Am J Hum Genet. 2014;94(2):233-245. Targeted genetic testing for familial hypercholesterolaemia using next generation sequencing: a population-based study. Norsworthy PJ et al. BMC Med Genet. 2014;15:70. Actionable, pathogenic incidental findings in 1,000 participants’ exomes. Dorschner MO et al. Am J Hum Genet. 2013;93(4):631-640. Actionable Exomic Incidental Findings in 6503 Participants: Challenges of Variant Classification. Amendola LM et al. Genome Res. 2015;25(3):305-315. Polygenic Versus Monogenic Causes of Hypercholesterolemia Ascertained Clinically. Wang J et al. Arterioscler Thromb Vasc Biol. 2016;36(12):2439-2445. Variability in assigning pathogenicity to incidental findings: insights from LDLR sequence linked to the electronic health record in 1013 individuals. Safarova MS et al. Eur J Hum Genet. 2017;25(4):410-415. |
| p.Cys63Phe (C42F) | Exon 2 | 63 (old: 42) | Cysteine (Cys or C) to Phenylalanine (Phe or F) | - | 188 | TGC | TCC | 3; the mutation has occurred in the ligand binding domain and interferes with the binding of the LDL particle to the LDL-receptor | The Netherlands` | Dutch, Turkish | rare; 2 Dutch index cases, 1 Turkish index case. In total 4 cases (status 07-09-2023) | In Italy and Canada the p.Cys63Arg variant is reported. In Oct. 2019 we identified the c.187T>G; p.Cys63Gly variant. | not described in literature |
| c.148del; p.Ala50Leufs*156 | Exon 2 | NA | Frameshift causes stop at amino acid position 184 | - | 148 | - | - | 1:null allele; no protein synthesized from this allele | The Netherlands | Dutch | 55 patients identified (status 09-11-2023) | - | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. |
| c.190+4A>T | Intron 2 | NA | Skipping of exon 2 | - | 190+4 | A | T | 1:null allele; no protein synthesized from this allel | The Netherlands, Norway, Far-East, Canada/Philippines | Dutch, Indonesia (Mollucas and Java), Antilles, USA (homozygous Philippino patient from Canada) | 17 families in the Netherlands (5 Asian), in total 73 patients (status 16-05-2024) | 3′-splice acceptor site disrupted, production of unstable mRNA (lacking exon 2) which is rapidly degraded. The Asian families originate from the Indonesian Moluccan and Java islands. | Risk of Premature Atherosclerotic Disease in Patients With Monogenic Versus Polygenic Familial Hypercholesterolemia. Tri…Risk of Premature Atherosclerotic Disease in Patients With Monogenic Versus Polygenic Familial Hypercholesterolemia. Trinder M et al. J Am Coll Cardiol. 2019;74(4):512-522.Polygenic Versus Monogenic Causes of Hypercholesterolemia Ascertained Clinically. Wang J et al. Arterioscler Thromb Vasc Biol. 2016;36(12):2439-2445. Analysis of sequence variations in low-density lipoprotein receptor gene among Malaysian patients with familial hypercholesterolemia. Al-Khateeb A et al. BMC Med Genet. 2011;12:40. Mutation detection rate and spectrum in familial hypercholesterolaemia patients in the UK pilot cascade project. Taylor A et al. Clin Genet. 2010;77(6):572-580. Effects of intronic mutations in the LDLR gene on pre-mRNA splicing: Comparison of wet-lab and bioinformatics analyses. Holla ØL et al. Mol Genet Metab. 2009;96(4):245-252. Aberrant 5′ splice sites in human disease genes: mutation pattern, nucleotide structure and comparison of computational tools that predict their utilization. Buratti E et al. Nucleic Acids Res. 2007;35(13):4250-4263. Low density lipoprotein-receptor (LDL-R) gene mutations among Filipinos with familial hypercholesterolemia. Punzalan FE et al. J Atheroscler Thromb. 2005;12(5):276-283. Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. Application of molecular genetics for diagnosing familial hypercholesterolemia in Norway: results from a family-based reening program. Leren TP et al. Semin Vasc Med. 2004;4(1):75-85. Statistical features of human exons and their flanking regions. Zhang MQ. Hum Mol Genet. 1998;7(5):919-932. |
| c.191-2A>G | Intron 2 | NA | No protein synthesized from this allel | - | 191-2 | A | G | 1:null allele; no protein synthesized from this allel | The Netherlands, UK | Dutch | frequent: 624 patients identified (status 06-11-2023) | 5′-splice donor site disrupted, production of unstable mRNA which is rapidly degraded.5′-splice donor site disrupted, production of unstable mRNA which is rapidly degraded.In the Netherlands this mutation is predominantly found in the province of Zeeland; This probably caused by a founder mutation due to geographic isolation in the past of this part of the country. We have identified one family with 15 relatives that have the c.191-2A>G AND c.313+1G>A variants on the same allele. In Japan the 191-1G>T variant is found. | Polygenic Versus Monogenic Causes of Hypercholesterolemia Ascertained Clinically. Wang J et al. Arterioscler Thromb Vasc…Polygenic Versus Monogenic Causes of Hypercholesterolemia Ascertained Clinically. Wang J et al. Arterioscler Thromb Vasc Biol. 2016;36(12):2439-2445.Cardiovascular risk in relation to functionality of sequence variants in the gene coding for the low-density lipoprotein receptor: a study among 29,365 individuals tested for 64 specific low-density lipoprotein-receptor sequence variants. Huijgen R, Kindt I, Defesche JC, Kastelein JJ. Eur Heart J. 201;33(18):2325-2330. Founder mutations in the Netherlands: geographical distribution of the most prevalent mutations in the low-density lipoprotein receptor and apolipoprotein B genes. Kusters DM, Huijgen R, Defesche JC et al. Neth Heart J. 2011;19(4):175-182. Molecular spectrum of autosomal dominant hypercholesterolemia in France. Marduel M et al. Hum Mutat. 2010;31(11):E1811-1824. Effects of intronic mutations in the LDLR gene on pre-mRNA splicing: Comparison of wet-lab and bioinformatics analyses. Holla ØL et al. Mol Genet Metab. 2009;96(4):245-252. The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC et al. Clin.Genet. 2000; 57:116-124. Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia. Day IN et al. Hum Mutat 1997; 10: 116-127. |
| p.Arg81Cys (R60C) | Exon 3 | 81 (old:60) | Arginine (R) to Cysteine (C) | - | 241 | CGC | TGC | 2B; delayed transport of receptor to cell surface | The Netherlands, Denmark, Portugal, South Africa | Dutch, Italian, Rumenian, Brasilian | 241 patients identified in the Netherlands (status 19-02-2024) | - | Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosi…Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosis 2008; 196: 633-642.The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615 Founder mutations in the LDL receptor gene contribute significantly to the familial hypercholesterolemia phenotype in the indigenous South African population of mixed ancestry.Loubser O, Marais AD, Kotze MJ et al. Clin Genet. 1999;55(5):340-345. Evaluation of a clinically applicable mutation screening technique for genetic diagnosis of familial hypercholesterolemia and familial defective apolipoprotein B.Nissen H, Hansen AB, Guldberg P, Hansen TS, Petersen NE, Horder M. Clin Genet. 1998 Jun;53(6):433-439. |
| p.Pro84Ser (P63S) | Exon 3 | 84 (old: 63) | Proline (Pro or P) to Serine (Ser or S) | - | 250 | CCT | TCT | 2B; delayed transport of receptor to cell surface | The Netherlands | Dutch | rare, 1 family in the Netherlands | In Ireland and Norway the p.Pro84Arg variant is known | The molecular basis of familial hypercholesterolemia in The Netherlands.Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. |
| p.Asp90Ala (D69A) | Exon 3 | 90 (old: 69) | Aspartic Acid (Asp or D) to Alanine (Ala or A) | - | 269 | GAT | GCT | 2A: blocked transport of receptor from cell surface to ER | USA | American | rare, 2 non-related homozygous americans | Other mutations at the same position: p.Asp90Glu (French, Dutch),p.Asp90Asn (Netherlands, UK, Malaysian, Chinese, p.Asp90Tyr (Indian, South African) and p.Asp90Gly (UK, USA). | not described in literature |
| p.Asp90Asn (D69N) | Exon 3 | 90 (old: 69) | Aspartic Acid (D) to Asparagine (N) | - | 268 | GAT | AAT | 2A: blocked transport of receptor from cell surface to ER | The Netherlands, UK, Italy, France, Turkey, China, Taiwan, Malyasia, Korea, New Zealand, Philippines, USA, Canada, South Africa | Dutch, Swiss, Turkish, Egypt, China | 76 patients (status 19-12-2023) | 2 compound heterozygous patients have been genotyped with p.Val523Met (Italian) and p.Cys222* (USA) on the other allele.2 compound heterozygous patients have been genotyped with p.Val523Met (Italian) and p.Cys222* (USA) on the other allele.Other mutations at the same position: p.Asp90Ala (USA), p.Asp90Glu (French), p.Asp90Tyr (Indian, South African) and p.Asp90Gly (UK, USA) | Polygenic Versus Monogenic Causes of Hypercholesterolemia Ascertained Clinically. Jian Wang J et al. Arterioscler Thromb…Polygenic Versus Monogenic Causes of Hypercholesterolemia Ascertained Clinically. Jian Wang J et al. Arterioscler Thromb Vasc Biol. 2016;36(12):2439-2445.Clinical features of familial hypercholesterolemia in Korea: Predictors of pathogenic mutations and coronary artery disease. Shin D et al. Atherosclerosis. 2015;243(1):53-58. Genetic testing of Korean familial hypercholesterolemia using whole-exome sequencing. Han SM et al. PLoS One. 2015 May 11;10(5):e0126706. Targeted genetic testing for familial hypercholesterolemia using next generation sequencing: a population-based study. Norsworthy PJ, Vandrovcova J, Thomas ERA et al. BMC Medical Genetics 2014;15:70-76. Spectrum of mutations and phenotypic expression in patients with autosomal dominant hypercholesterolemia identified in Italy. Bertolini S et al. Atherosclerosis. 2013;227(2):342-348. Cardiovascular risk in relation to functionality of sequence variants in the gene coding for the low-density lipoprotein receptor: a study among 29,365 individuals tested for 64 specific low-density lipoprotein-receptor sequence variants. Huijgen R, Kindt I, Defesche JC, Kastelein JJ. Eur Heart J. 2012;33(18):2325-2330. Detection of mutations and large rearrangements of the low-density lipo-protein receptor gene in Taiwanese patients with familial hypercholester-olemia. Chiou KR, Charng MJ. Am J Cardiol. 2010;105(12):1752-1758. Longitudinal evaluation and assessment of cardiovascular disease in patients with homozygous familial hypercholesterolemia. Kolansky DM et al. Am J Cardiol. 2008;102(11):1438-1443. Autosomal recessive hypercholesterolemia (ARH) and homozygous familial hypercholesterolemia (FH): a phenotypic comparison. Pisciotta L et al. Atherosclerosis. 2006;188(2):398-405. Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. The molecular basis of familial hypercholesterolaemia in Turkish patients. Sözen MM et al. Atherosclerosis. 2005;180(1):63-71. Low density lipoprotein-receptor (LDL-R) gene mutations among Filipinos with familial hypercholesterolemia. Punzalan FE et al. Atheroscler Thromb. 2005;12(5):276-283. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie, AD, Scott, R, George, PM. Atherosclerosis Supplements 2004;5:13-15 Identification and characterization of LDL receptor gene mutations in hyperlipidemic Chinese. Chang JH et al. J Lipid Res. 2003; 44:(10):1850-1858. Intronic mutations outside of Alu-repeat-rich domains of the LDL receptor gene are a cause of familial hypercholesterolemia. Amsellem S et al. Hum Genet. 2002;111(6):501-510. Low-density lipoprotein receptor gene mutations in a Southeast Asian population with familial hypercholesterolemia. Khoo KL, Van Acker P, Defesche JC et al. Clin Genet 2000; 58: 98-105. Mutations in the low-density lipoprotein receptor gene in Chinese familial hypercholesterolemia patients. Mak YT et al. Arterioscler Thromb Vasc Biol. 1998;18(10):1600-1605. Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia. Day IN et al. Hum Mutat 1997; 10:116-127. Identification of two new LDL-receptor mutations causing homozygous familial hypercholesterolemia in a South African of Indian origin. Rubinsztein DC et al. Biochim Biophys Acta. 1993;1182(1):75-82. Molecular genetics of the LDL receptor gene in familial hypercholes-terolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1: 445-466. |
| p.Gly98Ser (G77S) | Exon 3 | 98 (old: 77) | Glycine (Gly or G) to Serine (Ser or S) | - | 292 | GGC | AGC | 2B; delayed transport of receptor to cell surface | The Netherlands | Dutch, Chinese | rare, 1 family and 3 patients in the Netherlands (identified in January 2004). A Chinese index case was indentified on March 1, 2022. | Two of the 3 known carriers also have the R3500Q mutation.Two of the 3 known carriers also have the R3500Q mutation.at the same position the variant P.Gly98Arg (Portuguese) is known. The Chinese patient also had the p.Aso622Asn variant, in cis position. According to Liang et al. (2017), p.Asp622Asno only slightly reduces LDLR activity, but the presence of the variant p.Gly98Ser in cis position reduces the LDLR activity to 40% of normal. | Analysis of LDLR variants from homozygous FH patients carrying multiple mutations in the LDLR gene. Liang L et al. Ather…Analysis of LDLR variants from homozygous FH patients carrying multiple mutations in the LDLR gene. Liang L et al. Atherosclerosis 2017;263:163-170.Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. |
| p.Asp100Gly (D79G) | Exon 3 | 100 (old: 79) | Aspartic Acid (Asp or D) to Glycine (Gly or G) | - | 299 | GAC | GGC | 2B; delayed transport of receptor to cell surface | The Netherlands | Dutch | rare; 3 index cases and 6 affected family members in the Netherlands (Jan. 2012) | At the same position the variants p.Asp100Glu and p.Asp1009Ala (Dutch) and p.Asp100Asn (Norwegian) are also known. | The molecular basis of familial hypercholesterolemia in The Netherlands.Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. |
| p.Glu101* (E80X) | Exon 3 | 101 (old: 80) | Glutamic Acid (Glu or E) to stop (* or X) | Finn-1, Imperia | 301 | GAG | TAG | 1:null allele; no protein synthesized from this allele | Finland, Italy, Sweden, The Netherlands | Dutch | rare; 29 cariers identified (status 27-01-2021) | At the same position the p.Glu101Lys or FH-Lancashire (USA, UK, New Zealand) variant is also known | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001; 109: 602-615.Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis.Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001; 154: 243-246 Clinical expression of familial hypercholesterolemia in clusters of mutations of the LDL receptor gene that cause a receptor-defective or receptor-negative phenotype. Bertolini S, Cantafora A, Averna M, Cortese C, Motti C, Martini S, Pes G, Postiglione A, Stefanutti C, Blotta I, Pisciotta L, Rolleri M, Langheim S, Ghisellini M, Rabbone I, Calandra S. Arterioscler Thromb Vasc Biol. 2000; 20: E41-52. Molecular characterization of minor gene rearrangements in Finnish patients with heterozygous familial hypercholesterolemia: identification of two common missense mutations (Gly823–>Asp and Leu380–>His) and eight rare mutations of the LDL receptor gene.Koivisto UM, Viikari JS, Kontula K. Am J Hum Genet. 1995; 57: 789-797. |
| p.Gln102* (Q81X) | Exon 3 | 102 (old: 81) | Glutamine (Gln or Q) to Stop (* or X) | Rapone | 304 | CAA | CCA | 1:null allele; no protein synthesized from this allele | Malaysia, Italy | Malaysian | rare, 1 patient known (March 2002) | The patient is a boy from Malaysia suffering from homozygous FH. TheThe patient is a boy from Malaysia suffering from homozygous FH. TheQ81X-mutation is inherited from his mother. From his fathers side the boy has inherited the R385Q-mutation. This combination of mutations results in the classical form of homozygous FH: a total cholesterol level of 20.3 mmol/l and a LDL-cholesterol level of 18.7 mmol/l with normal values for HDL and triglycerides. Apart from massive xanthomas on the extensor tendons on hands and feet, the patient also has tuberous xanthomas on knees, elbows and buttocks. The family originates in India. Another mutation at the same position is: p.Gln102Pro | Clinical expression of familial hypercholesterolemia in clusters of mutations of the LDL receptor gene that cause a rece…Clinical expression of familial hypercholesterolemia in clusters of mutations of the LDL receptor gene that cause a receptor-defective or receptor-negative phenotype. Bertolini S, Cantafora A, Averna M, Cortese C, Motti C, Martini S, Pes G, Postiglione A, Stefanutti C, Blotta I, Pisciotta L, Rolleri M, Langheim S, Ghisellini M, Rabbone I, Calandra S. Arterioscler Thromb Vasc Biol. 2000;20:E41-52. |
| p.Gln102Pro (Q81P) | Exon 3 | 102 (old: 81) | Glutamine (Gln or Q) to Proline (Pro or P) | - | 305 | CAA | CCA | 2B; delayed transport of receptor to cell surface | The Netherlands | Dutch | 4 families, in total 33 carriers in the Netherlands (Feb. 2015) | Another mutation at the same position is: p.Gln102* | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mutat. 2005; 26: 550-556. |
| c.313+1 or +2 cluster | Intron 3 | NA | splice acceptor site disrupted, exon skipping (exon 3) | FH-Elverum (Norway), FH-Olbia (Italy) | 313+1 and 313+2 | G | A(+1) or G to C(+1) or T to C(+2) | 1:null allele; no protein synthesized from this allele | The Netherlands, Spain, Belgium, Germany, UK, Ireland, Austria, Norway, Denmark, Sweden, Italy, Korea, New Zealand, Russia, Portugal, Brazil | Dutch, Surinam, Aruba, Moroccan, Italian, Norwegian, Afghan | G to A (+1): frequent ;G to C (+1): rare; G to T (+1): rare; T to C (+2): rare. In total 2148 patients with 313+1 or +2 cluster have been identified, including 3 true homozygotes (status 21-03-2024). | This is a cluster of variants at the same position and is termed 313+1/2 (313 plus 1 or 2) because our PCR assay picks u…This is a cluster of variants at the same position and is termed 313+1/2 (313 plus 1 or 2) because our PCR assay picks up all 4 variants.At c.313+1 there is a G to C substitution, which is also found in Spanish patients. This variant is rare. The c.313+1G>C variant in Spanish patients is linked to the benign variant Gln92Glu Usually the c.313+1 G to A substitution (FH-Olbia) is found. This mutation is also known in Belgium, Germany, UK, Ireland, Austria, Norway, Denmark, Sweden, Italy, Spain,, Brazil Korea and New Zealand. A third, also rare, mutation is a T to C substitution at position c.313+2. This mutation is also found in Germany and Ireland. As a cause of these mutations, the 3′-splice acceptor site is disrupted, which results in the skipping of exon 3. Variants of this cluster are severe and cause very high LDL-cholesterol levels and a high risk for atherosclerosis. Ireland has also reported the c.313+1 G to T variant (Genetic screening protocol for familial hypercholesterolemia which includes splicing defects gives an improved mutation detection rate. Graham CA, McIlhatton BP, Kirk CW, Beattie ED, Lyttle K, Hart P, Neely RDG, Young IS, Nicholls DP. Atherosclerosis 2005; 182: 331-340.) | Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects. Jannes CE et al. Ather…Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects. Jannes CE et al. Atherosclerosis. 2014;238(1):101-107.New contributions to the study of common double mutants in the human LDL receptor gene. Tejedor M et al. Naturwissenschaften. 2011;98(11):943-949. Familial hypercholesterolaemia in Portugal. Bourbon M et al. Atherosclerosis 2008; 196: 633-642. Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I et al. Atherosclerosis. 2007;194(1):102-111. Familial hypercholesterolemia in St-Petersburg: the known and novel mutations found in the low density lipoprotein receptor gene in Russia. Zakharova FM et al. BMC Med Genet. 2005;6 :6 Laurie AD et al. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Atherosclerosis Supplements 2004;5:13-15 Low-Density Lipoprotein-receptor gene mutations and cardiovascular risk in a large genetic cascade screening population. Umans-Eckenhausen MAW, Sijbrands EJG, Kastelein JJP, Defesche JC. Circulation 2002; 106:3031-3036. The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Mutation analysis in 36 unrelated Spanish subjects with familial hypercholesterolemia: identification of 3 novel mutations in the LDL receptor gene. Mozas P et al. Hum Mutat. 2000 May;15(5):483-484. Mutations in the low density lipoprotein receptor gene of familial hypercholesterolemic patients detected by denaturing gradient gel electrophoresis and direct sequencing. Lombardi P et al. J Lipid Res. 1995 Apr;36(4):860-867. |
| c.314-1G>A | Intron 3 | NA | splice donor signal disrupted. | - | 314-1 | G | A | 1:null allele; no protein synthesized from this allele | The Netherlands, Austria, Portugal, France, UK | Dutch, Polish | 109 carriers in the Netherlands (status 25-01-2024) | A similar mutation is known: 314-3C>T | Familial hypercholesterolemia mutations in the Middle Eastern and North African region: a need for a national registry. …Familial hypercholesterolemia mutations in the Middle Eastern and North African region: a need for a national registry. Bamimore MA et al. J Clin Lipidol. 2015;9(2):187-194.Targeted genetic testing for familial hypercholesterolaemia using next generation sequencing: a population-based study. Norsworthy PJ et al. BMC Med Genet. 2014;15:70. Molecular spectrum of autosomal dominant hypercholesterolemia in France. Marduel M et al. Hum Mutat. 2010;31(11):E1811-E1824. Cardiovascular risk in relation to functionality of sequence variants in the gene coding for the low-density lipoprotein receptor: a study among 29,365 individuals tested for 64 specific low-density lipoprotein-receptor sequence variants. Huijgen R et al. Eur Heart J. 2012;33(18):2325-2330. Effects of intronic mutations in the LDLR gene on pre-mRNA splicing: Comparison of wet-lab and bioinformatics analyses. Holla ØL et al. Mol Genet Metab. 2009;96(4):245-252. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KEet al. Atherosclerosis. 2001;154(1):243-246. Influence of genotype at the low density lipoprotein (LDL) receptor gene locus on the clinical phenotype and response to lipid-lowering drug therapy in heterozygous familial hypercholesterolaemia. The Familial Hypercholesterolaemia Regression Study Group. Sun XM et al. Atherosclerosis 1998;136(1):175-185. Identification of three new mutations of the low density lipoprotein receptor gene in Dutch familial hypercholesterolemic patients. Lombardi P et al. Hum Mutat. 1998;Suppl 1:S172-174. |
| p.Glu113Lys (E92K) | Exon 4 | 113 (old: 92) | Glutamic Acid (Glu or E) to Lysine (Lys or K) | - | 337 | GAG | AAG | 2B; delayed transport of receptor to cell surface | The Netherlands | Dutch | rare; one family with 9 carriers (March 2007) | - | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| p.Arg124Gly (R103G) | Exon 4 | 124 (old: 103) | Arginine (Arg or R) to Glycine (Gly or G) | - | 370 | CGG | GGG | 2B; delayed transport of receptor to cell surface | The Netherlands | Dutch | rare | - | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. |
| p.Cys134Arg (C113R) | Exon 4 | 134 (old: 134) | Cysteine (C or Cys) to Arginine (R or Arg) | - | 400 | TGC | GAC | 2B; delayed transport of receptor to cell surface | The Netherlands, Germany, Malaysia | Dutch, Malay | 2 Dutch, 2 Malay patients (status 24-04-2014) | At the same position the variants C113F (Japanese) and C113W (Italian) are known | The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615.Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001 Jan;154(1):243-246. |
| p.Glu140Asp (E119D) | Exon 4 | 140 (old: 119) | Glutamic Acid (Glu or E) to Aspartic Acid (Asp or D) | - | 420 | GAG | GAC | 2B; delayed transport of receptor to cell surface | Czech Republic, The Netherlands, USA, UK | Dutch, USA | rare | Other mutations at the same position are:Other mutations at the same position are:p.Glu140Gly (The Netherlands) p.Glu140Lys (USA, Philippines, Denmark, Canada, Japan, Spain, Italy) p.Glu140* or FH-Venezuela/FH-Campobaso (Belgium,Netherlands, Venezuela, Italy) This mutation was also found in an American homozygous patient in combination with D151N. | An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lu…An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskova, Lenka Kopeckova, Eva Jansova et al. Atherosclerosis 2011;216:139-145.Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I, Toledo-Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Atherosclerosis. 2007;194(1):102-111. |
| p.Glu140Gly (E119G) | Exon 4 | 140 (old: 119) | Glutamic Acid (Glu or E) to Glycine (Gly or G) | - | 419 | GAG | GGG | 2B; delayed transport of receptor to cell surface | The Netherlands | Dutch | rare: one family known with 3 affected family members (status 18-08-2023) | Other mutations at the same position are:Other mutations at the same position are:p.Glu140Asp (The Netherlands, USA) p.Glu140Lys (USA, Philippines, Denmark, Canada, Japan, Spain, Italy) p*Glu140X or FH-Venezuela/FH-Campobaso (Belgium, Netherlands, Venezuela, Italy) | The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. |
| p.Cys143* (C122X) | Exon 4 | 143 (old: 122) | Cysteine (Cys or C) to Stop (* or X) | - | 429 | TGC | TGA | 1:null allele; no protein synthesized from this allele | The Netherlands, Denmark, Sweden, Belgium, France | Dutch, Argentina | frequent: 141 cases known (status 02-11-2023) | At the same position the variant p.Cys143Gly is also known. This mutation was found in an American patient of Canadian-Philippine origin. | High prevalence of a novel mutation in the exon 4 of the low-density lipoprotein receptor gene causing familial hypercho…High prevalence of a novel mutation in the exon 4 of the low-density lipoprotein receptor gene causing familial hypercholesterolemia in Belgium. Descamps O et al. Clin Genet. 1997;51(5):303-308.Mutations in the low-density lipoprotein receptor gene in Swedish familial hypercholesterolaemia patients: clinical expression and treatment response. Ekstrom U et al. Eur J Clin Invest. 1998;28(9):740-747. The genotype interactions of methylenetetrahydrofolate reductase and renin-angiotensin system genes are associated with myocardial infarction. Fernandez-Arcas N et al. Atherosclerosis. 1999;145(2):293-300. The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW et al. Hum Genet 2001; 109: 602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath K et al. 2001;154(1):243-246. |
| p.Cys148Tyr (C127Y) | Exon 4 | 148 (old: 127) | Cysteine (Cys or C) to Tyrosine (Tyr or Y) | - | 443 | TGT | TAT | 2A: blocked transport of receptor from endoplasmatic reticulum to Golgi complex | The Netherlands, Germany | Dutch, Turkish and Afghan | rare: 6 patients in the Netherlands (status 27-09-2023) | In St. Petersburg, Russia, the variant p.Cys148Trp in found. | Identification of recurrent and novel mutations in the LDL receptor gene in German patients with familial hypercholester…Identification of recurrent and novel mutations in the LDL receptor gene in German patients with familial hypercholesterolemia. Nauck MS, Koster W, Dorfer K, Eckes J, Scharnagl H, Gierens H, Nissen H, Nauck MA, Wieland H, Marz W. Hum Mutat 2001;18:165-166.Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| p.Ala151Pro (A130P) | Exon 4 | 151 (old: 130) | Alanine (Ala or A) to Proline (Pro or P)) | - | 451 | GGC | CCC | 3; the mutation has occurred in the ligand binding domain and interferes with the binding of the LDL particle to the LDL-receptor | Russia, The Netherlands | Dutch | rare, 1 family in the Netherlands (February 2005) | At the same position the variant p.Ala151Thr (Dutch) is also known. | Familial hypercholesterolemia in St-Petersburg: the known and novel mutations found in the low density lipoprotein recep…Familial hypercholesterolemia in St-Petersburg: the known and novel mutations found in the low density lipoprotein receptor gene in Russia.Zakharova FM, Damgaard D, Mandelshtam MY, Golubkov VI, Nissen PH, Nilsen GG, Stenderup A, Lipovetsky BM, Konstantinov VO, Denisenko AD, Vasilyev VB, Faergeman O.BMC Med Genet. 2005;6 :6 Four new mutations and polymorphic variants of the low density lipoprotein receptor in patients with familial hypercholesterolemia in Saint Petersburg. Tatishcheva I, Mandel’shtam M, Golubkov VI, Lipovetskii BM, Gaitskhoki VS. Genetika. 2001; 37: 1290-1295 |
| p.Cys155Gly (C134G) | Exon 4 | 155 (old 134) | Cysteine (C) to Glycine (G) | Germany | 463 | TGC | GGC | 2B; delayed transport of receptor to cell surface | The Netherlands, Norway, Poland, Germany | Dutch | 28 patients in the Netherlands. One index case from Germany identified during the course of a clinical trial (status 15-06-2023). | On the same position the variants C134X (Norwegian), C134Y (Dutch, French, Spanish), C134F (Dutch) and C134R (Malay, Japanese) are known. | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-15.Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001 Jan;154(1):243-246. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet. 2000 Feb;57(2):116-124. Molecular genetics of familial hypercholesterolaemia in Norway. Leren TP, Tonstad S, Gundersen KE, Bakken KS, Rodningen OK, Sundvold H, Ose L, Berg K. J Intern Med. 1997 Mar;241(3):185-194. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1(6):445-466. |
| p.Cys167* (C146X) | Exon 4 | 167 (146 old) | Cysteine (C) to Stop (X) | - | 501 | TGC | TGA | 1:null allele; no protein synthesized from this allel | Austria, The Netherlands, UK, Czech Republic | Dutch, Indonesian, Iran | frequent: 118 cases in the Netherlands (status 01-02-2024) | In St. Petersburg, Russia, the p.Cys167Arg variant in found. In Japan the p.Cys167Tyr variant is found. Also the p.Cys167Trp variant is known (Dutch and unknown origin). | An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lu…An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskova, Lenka Kopeckova, Eva Jansova et al. Atherosclerosis 2011;216:139-145.Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I, Toledo-Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Atherosclerosis. 2007;194(1):102-111. Use of denaturing HPLC to provide efficient detection of mutations causing familial hypercholesterolemia. Bodamer OA et al. Clin Chem. 2002;48(11):1913-1918. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001;109(6):602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001;154(1):243-246. Evidence for a cholesteryl ester donor activity of LDL particles during alimentary lipemia in normolipidemic subjects. Lassel TS, Guerin M, Auboiron S, Guy-Grand B, Chapman MJ. Atherosclerosis. 1999;147(1):41-48. Mutations in the low density lipoprotein receptor gene of familial hypercholesterolemic patients detected by denaturing gradient gel electrophoresis and direct sequencing.Lombardi P, Sijbrands EJ, van de Giessen K, Smelt AH, Kastelein JJ, Frants RR, Havekes LM. J Lipid Res. 1995;36(4):860-867. |
| p.Asp168His (D147H) | Exon 4 | 168 (147 old) | Aspartic Acid (D) to Histidine (H) | FH-Sephardic | 502 | GAC | CAC | 2B; delayed transport of receptor from endoplasmatic reticulum to Golgi complex | Israel, The Netherlands | Israel, Turkey | 7 patients known in the Netherlands (status Sep. 2019) | This is a frequent (10%) mutation in the Sephardic Jewish community. In New Zealand and the Philippines the D147N and in Norway the D147Y variants are known. | Molecular genetics of familial hypercholesterolemia in Israel. Reshef A, Nissen H, Triger L, Hensen TS, Eliav O, Schurr …Molecular genetics of familial hypercholesterolemia in Israel. Reshef A, Nissen H, Triger L, Hensen TS, Eliav O, Schurr D, Safadi R, Gare M, Leitersdorf E. Hum Genet. 1996; 98:581-586.Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| p.Cys173Trp (C152W) | Exon 4 | 173 (152 old) | Cysteine (C) to Tryptophan (W) | - | 519 | TGC | TGG | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | Canada, Germany, UK, The Netherlands, Korea, Poland, Germany, Venezuela | Dutch | 47 patients identified (status 29-05-2020) | In Ireland and the Netherlands the p.Cys173* variant is known and in Spain the p.Cys17Tyr variant. Recently p.Cys173Arg was identified in a Malaysian patient. | Clinical features of familial hypercholesterolemia in Korea: Predictors of pathogenic mutations and coronary artery dise…Clinical features of familial hypercholesterolemia in Korea: Predictors of pathogenic mutations and coronary artery disease - A study supported by the Korean Society of Lipidology and Atherosclerosis. Shin DG et al. Atherosclerosis. 2015;243(1):53-58.Genetic testing of Korean familial hypercholesterolemia using whole-exome sequencing. Han SM et al. PLoS One. 2015;10(5):e0126706. Novel mutations identification in exon 4 of LDLR gene in patients with moderate hypercholesterolemia in a Venezuelan population. Arráiz N et al. Am J Ther. 2010;17(3):325-329. Monogenic hypercholesterolaemias--an evaluation of apolipoprotein B100 and LDL receptor gene polymorphisms. Plewa R et al. Kardiol Pol. 2006;64(2):127-133. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001;109(6):602-615. Identification of recurrent and novel mutations in the LDL receptor gene in German patients with familial hypercholesterolemia. Nauck MS, et al. Hum Mutat. 2001 Aug;18(2):165-166. Mutation analysis in 46 German families with familial hypercholesterolemia: identification of 8 new mutations. Mutations in brief no. 226. Online. Ebhardt M et al. Hum Mutat. 1999;13(3):257. Identification of three mutations in the low-density lipoprotein receptor gene causing familial hypercholesterolemia among French Canadians. Couture P et al. Hum Mutat. 1998;Suppl 1:S226-31. A novel mutation in Exon 4 of the low density lipoprotein receptor gene resulting in heterozygous familial hypercholesterolemia associated with decreased ligand binding. Morash BA, Tan MH, Nassar BA, Too CK, Guernsey DL. Atherosclerosis. 1998;136(1):9-16. |
| p.Ser177Leu (S156L) | Exon 4 | 177 (old: 156) | Serine (S) to Leucine (L) | Puerto Rico | 530 | TCG | TTG | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, UK, Spain, USA, Germany, Norway, Poland, Portugal, Czech Republic, France, Puerto Rico, China, Japan, Brazil, India, Malaysia | Dutch, Puerto Rican, Pakistan/Surinam, Japan, Spain, Portugal, Poland | 49 patients identified, including two true homozygotes (status 05-02-2024) | On Oct. 7, 2000 this mutation was also identified in a true homozygote from the USA, of Puertorican origin. On Dec. 10, 2013 we identified p.Ser177Leu in a patient from Japan. | Genetic variations in familial hypercholesterolemia and cascade screening in East Asians. Chan ML et al. Mol Genet Genom…Genetic variations in familial hypercholesterolemia and cascade screening in East Asians. Chan ML et al. Mol Genet Genomic Med. 2019;7(2):e00520.Heterozygous familial hypercholesterolaemia in a pair of identical twins: a case report and updated review. Mohd Nor NS et al. BMC Pediatr. 2019;19(1):106. The genetic spectrum of familial hypercholesterolemia in south-eastern Poland. Sharifi M et al. Metabolism. 2016 Mar;65(3):48-53. Spectrum of mutations in homozygous familial hypercholesterolemia in India, with four novel mutations. Setia N et el. Atherosclerosis. 2016;255:31-36. Systematic cell-based phenotyping of missense alleles empowers rare variant association studies: a case for LDLR and myocardial infarction. Thormaehlen AS et al. PLoS Genet 2015;11:e1004855. Familial hypercholesterolemia in Brazil: cascade screening program, clinical and genetic aspects. Jannes CE et al. Atherosclerosis 2015;238(1):101-107. Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects. Jannes CE et al. Atherosclerosis. 2014;238(1):101-107. The molecular basis of familial hypercholesterolemia in the Czech Republic: spectrum of LDLR mutations and genotype-phenotype correlations. Tichý L et al. Atherosclerosis. 2012 Aug;223(2):401-408. An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskova, Lenka Kopeckova, Eva Jansova et al. Atherosclerosis 2011;216:139-145. Molecular characterization of Polish patients with familial hyper-cholesterolemia: novel and recurrent LDLR mutations. Chmara M et al. J Appl Genet. 2010;51(1):95-106. Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosis 2008; 196: 633-642. Clinical course of homozygous familial hypercholesterolemia during childhood: report on 4 unrelated patients with homozygous or compound heterozygous mutations in the LDLR gene. Kubalska J et al. J Appl Genet. 2008;49(1):109-113. Spectrum of low density lipoprotein receptor mutations in Czech hyper-cholesterolemic patients. Kuhrová V et al. Hum Mutat. 2002;19(1):80. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE et al. Atherosclerosis. 2001;154(1):243-246. Mutation analysis in 36 unrelated Spanish subjects with familial hypercholesterolemia: identification of 3 novel mutations in the LDL receptor gene. Mozas P, Cenarro A, Civeira F, Castillo S, Ros E, Pocovi M. Hum Mutat. 2000;15(5):483-484. LDL-R and Apo-B-100 gene mutations in Polish familial hypercholestero-lemias. Gorski B et al. Hum Genet. 1998;102(5):562-655. Phenotypic variation in heterozygous familial hypercholesterolemia: a comparison of Chinese patients with the same or similar mutations in the LDL receptor gene in China or Canada. Pimstone SN et al. Arterioscler Thromb Vasc Biol. 1998 Feb;18(2):309-315. Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia. Day IN et al. Hum Mutat. 1997;10(2):116-127. Two novel mutations in the LDL receptor gene: common causes of familial hypercholesterolemia in a Spanish population. Cenarro A et al. Clin Genet. 1996;49(4):180-185. Mutations in the low density lipoprotein receptor gene of familial hypercholesterolemic patients detected by denaturing gradient gel electrophoresis and direct sequencing. Lombardi P et al. J Lipid Res. 1995;36(4):860-867. Identification of the serine-156 to leucine mutation in the low-density lipoprotein receptor in a German family with familial hypercholesterolemia. Schuster H et el. Clin Investig. 1993 Feb;71(2):172-175. Evidence for a dominant gene that suppresses hypercholesterolemia in a family with defective low density lipoprotein receptors. Hobbs HH et al. J Clin Invest. 1989 Aug;84(2):656-664 |
| p.Cys184Arg (C163R) | Exon 4 | 184 (163 old) | Cysteine (C) to Arginine (R) | - | 550 | TGT | CGT | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, China, Syria, Japan | Dutch | frequent; 168 patients including 2 double heterozygotes, identified in the Netherlands (status 11-05-2023) | Other mutations at the same position: p.Cys184Tyr (Dutch, British, Irish American, Italian), c.Cys184Trp (Dutch, Polish,…Other mutations at the same position: p.Cys184Tyr (Dutch, British, Irish American, Italian), c.Cys184Trp (Dutch, Polish, German, Russian) and p.Cys184Tyr (Dutch, British, Irish, American, Italian) and p.Cys184Gly (Malaysian/Chinese) | Mutations in Japanese subjects with primary hyperlipidemia. Results from the Research Committee of the Ministry of Healt…Mutations in Japanese subjects with primary hyperlipidemia. Results from the Research Committee of the Ministry of Health and Welfare of Japan since 1996 -. Maruyama T, Yamashita S, Matsuzawa Y et al. J Atheroscler and Thromb. 2004;11(3):131-145.Molecular genetic analysis of familial hypercholesterolemia: spectrum and regional difference of LDL receptor gene mutations in Japanese population. Yu W, nohara A, Higashikata T, Lu H, Inazu A, Mabuchi H. Atherosclerosis 2002;165:335-342. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001 Jan;154(1):243-246. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet. 2000 Feb;57(2):116-124. Phenotypic variation in heterozygous familial hypercholesterolemia: a comparison of Chinese patients with the same or similar mutations in the LDL receptor gene in China or Canada. Pimstone SN, Sun XM, du Souich C, Frohlich JJ, Hayden MR, Soutar AK. Arterioscler Thromb Vasc Biol. 1998 Feb;18(2):309-315. |
| p.Cys184Tyr (C163Y) | Exon 4 | 184 (old: 163) | Cysteine (Cys or C) to Tyrosine (Tyr or Y) | Rome-2 | 551 | TGT | TAT | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, UK, USA, Italy, Ireland, Portugal, Brazil | Dutch | rare; 10 patients identified in the Netherlands (Dec. 2014) | Other mutations at the same position: p.Cys184Arg (Dutch, Chinese, Japanese, Syrian), o.Cys184Trp (Dutch, Polish, German…Other mutations at the same position: p.Cys184Arg (Dutch, Chinese, Japanese, Syrian), o.Cys184Trp (Dutch, Polish, German, Russian) and p.Cys184Tyr (Dutch, British, Irish, American, Italian) and p.Cys184Gly (Malaysian/Chinese).The p.Cys184Tyr mutation is frequent in the Glasgow area in the UK. | Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, d…Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, de Souza Silva PR, Turolla L, Gagliardi AC, Marsiglia JD, Chacra AP, Miname MH, Rocha VZ, Filho WS, Krieger JE, Pereira AC. Atherosclerosis. 2014;238(1):101-107.Analysis of the frequency and spectrum of mutations recognised to cause familial hypercholesterolaemia in routine clinical practice in a UK specialist hospital lipid clinic. Futema M, Whittall RA, Kiley A et al. Atherosclerosis 2013;229:161-168. Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosis 2008; 196: 633-642. Genetic screening protocol for familial hypercholesterolemia which includes splicing defects gives an improved mutation detection rate. Graham CA, McIlhatton BP, Kirk CW, Beattie ED, Lyttle K, Hart P, Neely RDG, Young IS, Nicholls DP. Atherosclerosis 2005; 182: 331-340. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001 Jan;154(1):243-246. Evidence for a cholesteryl ester donor activity of LDL particles during alimentary lipemia in normolipidemic subjects. Lassel TS, Guerin M, Auboiron S, Guy-Grand B, Chapman MJ. Atherosclerosis. 1999 Nov 1;147(1):41-48. |
| p.Pro196Thr (P175T) | Exon 4 | 196 (old: 175) | Proline (Pro or P) to Threonine (Thr or T) | - | 586 | CCC | ACC | 3; the mutation has occurred in the ligand binding domain and interferes with the binding of the LDL particle to the LDL-receptor | The Netherlands | Dutch (West Frisia) | rare, 1 family known (Apr. 2012) | - | not described in literature |
| p.Glu208Lys (E187K) | Exon 4 | 208 (old: 187) | Glutamic Acid (Glu or E) to Lysine (Lys or K) | Jerusalem | 622 | GAG | AAG | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, South Africa, Israel, Czech Republic, Russia | Dutch | 87 cariers in the Netherlands (status 15-03-2022) | Another mutation at the same position is p.Glu208* (Norwegian) | Cardiovascular risk in relation to functionality of sequence variants in the gene coding for the low-density lipoprotein…Cardiovascular risk in relation to functionality of sequence variants in the gene coding for the low-density lipoprotein receptor: a study among 29,365 individuals tested for 64 specific low-density lipoprotein-receptor sequence variants. Huijgen R, Kindt I, Defesche JC, Kastelein JJ.Eur Heart J. 2012;33(18):2325-2330. Spectrum of low density lipoprotein receptor mutations in Czech hypercholesterolemic patients. Kuhrová V et al. Hum Mutat. 2002;19(1):80. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-15. Four new mutations and polymorphic variants of the low density lipoprotein receptor in patients with familial hypercholesterolemia in Saint Petersburg. Tatishcheva IuA et al. Genetika 2001 Sep;37(9):1290-1295. Molecular genetics of familial hypercholesterolemia in Israel. Reshef A, Nissen H, Triger L, Hensen TS, Eliav O, Schurr D, Safadi R, Gare M, Leitersdorf E. Hum Genet. 1996 Nov;98(5):581-586. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1(6):445-466. The identification of two low-density lipoprotein receptor gene mutations in South African familial hypercholesterolaemia. Kotze MJ, Langenhoven E, Warnich L, du Plessis L, Marx MP, Oosthuizen CJ, Retief AE. S Afr Med J. 1989 Oct 21;76(8):399-401. |
| p.Asp221Gly (D200G) | Exon 4 | 221 (200 old) | Aspartic Acid (D) to Glycine (G) | Padova-1 | 662 | GAC | GGC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, Italy, Spain, UK, Ireland, Norway, Germany, Austria, Sweden, South Africa, USA, Portugal, Czech Republic, Brazil, Uruguay | Dutch, South Africa, Brasil | 110cases identified, including one homozygote and one double heterozygote (with p.Arg3527Gln in APOB) (status 01-02-2024). | p.Asp221Gly has 8% residual activity. Other mutations at the same position: p.Asp221Asn (global) and p.Asp221Tyr (Portuguese) | Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, d…Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, de Souza Silva PR, Turolla L, Gagliardi AC, Marsiglia JD, Chacra AP, Miname MH, Rocha VZ, Filho WS, Krieger JE, Pereira AC. Atherosclerosis. 2014;238(1):101-107.An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskov, Lenka Kopeckov, Eva Jansov et al. Atherosclerosis 2011;216:139-145. Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I, Toledo-Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Atherosclerosis. 2007;194(1):102-111. Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosis 2008; 196: 633-642. Genetic screening protocol for familial hypercholesterolemia which includes splicing defects gives an improved mutation detection rate. Graham CA, McIlhatton BP, Kirk CW, Beattie ED, Lyttle K, Hart P, Neely RDG, Young IS, Nicholls DP. Atherosclerosis 2005; 182: 331-340. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001 Jan;154(1):243-246. Clinical expression of familial hypercholesterolemia in clusters of mutations of the LDL receptor gene that cause a receptor-defective or receptor-negative phenotype. Bertolini S, Cantafora A, Averna M, Cortese C, Motti C, Martini S, Pes G, Postiglione A, Stefanutti C, Blotta I, Pisciotta L, Rolleri M, Langheim S, Ghisellini M, Rabbone I, Calandra S. Arterioscler Thromb Vasc Biol. 2000 Sep;20(9):E41-52. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet. 2000 Feb;57(2):116-124. Mutation analysis in 36 unrelated Spanish subjects with familial hypercholesterolemia: identification of 3 novel mutations in the LDL receptor gene. Mozas P, Cenarro A, Civeira F, Castillo S, Ros E, Pocovi M. Hum Mutat. 2000 May;15(5):483-484. Mutation screening and genotype:phenotype correlation in familial hypercholesterolaemia.Graham CA, McClean E, Ward AJ, Beattie ED, Martin S, O’Kane M, Young IS, Nicholls DP. Atherosclerosis. 1999 Dec;147(2):309-316. Molecular genetics of familial hypercholesterolaemia in Norway. Leren TP, Tonstad S, Gundersen KE, Bakken KS, Rodningen OK, Sundvold H, Ose L, Berg K. J Intern Med. 1997 Mar;241(3):185-194. Screening for mutations in exon 4 of the LDL receptor gene in a German population with severe hypercholesterolemia. Giesel J, Holzem G, Oette K. Hum Genet. 1995 Sep;96(3):301-4. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1(6):445-466. |
| p.Asp221Asn (D200N) | Exon 4 | 221 (old: 200) | Aspartic Acid (Asp or D) to Asparagine (Asn or N) | - | 661 | GAC | AAC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, UK, Germany, Norway, Korea | Dutch, Spain (one patient) | rare, 8 cases known in The Netherlands (status 09-02-2024) | Other mutations at the same position: p.Asp221Gly (global) and p.Asp221Tyr (Portuguese) | Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor…Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I, Toledo-Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Atherosclerosis. 2007;194(1):102-111.Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. Novel and recurrent mutations of the LDL receptor gene in Korean patients with familial hypercholesterolemia. Kim JH, Choi HK, Lee H, Park HY, Kim JH, Kim JW, Kim HJ, Lee ST. Mol Cells. 2004; 18: 63-70. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001; 154: 243-246. Ebhardt M, Schmidt H, Doerk T, Tietge U, Haas R, Manns MP, Schmidtke J, Stuhrmann M. Mutation analysis in 46 German families with familial hypercholesterolemia: identification of 8 new mutations. Mutations in brief.Hum Mutat. 1999; 13: 257. Screening for mutations in exon 4 of the LDL receptor gene in a German population with severe hypercholesterolemia. Giesel J, Holzem G, Oette K. Hum Genet. 1995; 96: 301-304 |
| p.Cys222Phe (C201F) | Exon 4 | 222 (old: 201) | Cysteine (Cys or C) to Phenylalanine (Phe or F) | - | 665 | TGC | TTC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands | Dutch | rare; 7 patients known (status 10-03-2023) | Other mutations at the same position: p.Cys222* (Bulgarian), p.Cus222Arg (Turkish, Australian, Dutch) and p.Cus222Tyr (Italian) | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. |
| p.Cys222* (C201X) | Exon 4 | 222 (old: 201) | Cysteine (Cys or C) to Stop (* or X) | - | 666 | TGC | TGA | 1:null allele; no protein synthesized from this allele | Bulgaria, Japan, Italy, The Netherlands, Poland, Romania | Bulgarian, Italian, Dutch, Romanian | 7 patients identified. (status 05-01-2024). | 1 Bulgarian compound heterozygous patient and his daughter. The other allele in the Bulgarian homozygote is E336G. Durin…1 Bulgarian compound heterozygous patient and his daughter. The other allele in the Bulgarian homozygote is E336G. During the course of a clinical trial an Italian compound heterozygous patient with D69N on the other allele was identified. In November we identified a boy from Rumania with C201X and G571 on the other allele.Other mutations at the same position: p.Cys222= and p.Cys222Phe (Dutch), p.Cys222aRG (Turkish, Australian, Dutch) and p.Cys222tYR (Italian). | Molecular characterization of Polish patients with familial hypercholesterolemia: novel and recurrent LDLR mutations. M.…Molecular characterization of Polish patients with familial hypercholesterolemia: novel and recurrent LDLR mutations. M. Chmara, B. Wasag, M. Zuk, J. Kubalska, A. Wagrzyn, M. Bednarska-Makaruk, E. Pronicka, H. Wehr, J. C. Defesche, A. Rynkiewicz, J. Limon. J Appl Genet 2010;51(1):95-106.Update of Japanese common LDLR gene mutations and their phenotypes: Mild type mutation L547V might predominate in the Japanese population. Yasuko Miyake,Taku Yamamura, Naohiko Sakai, Toshiyuki Miyata, Yoshihiro Kokubo, Akira Yamamoto. Atherosclerosis 2009;203:153-160. Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet. 2000;57(2):116-124. |
| p.Asp224Val (D203V) | Exon 4 | 224 (old: 203) | Aspartic Acid (Asp or D) to Valine (Val or V) | - | 671 | GAC | GTC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, Germany | Dutch | 19 index cases, in total 55 carriers (status 19-09-2022) | Another mutation at the same position is: p.Asp224Asn (US, Portuguese) | The molecular basis of familial hypercholesterolemia in The Netherlands.Fouchier SW, Defesche JC, Umans-Eckenhausen MAW,…The molecular basis of familial hypercholesterolemia in The Netherlands.Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615.Screening for mutations in exon 4 of the LDL receptor gene in a German population with severe hypercholesterolemia. Giesel J, Holzem G, Oette K. Hum Genet. 1995 Sep;96(3):301-4. |
| p.Asp224Asn (D203N) | Exon 4 | 224 (old: 203) | Aspartic Acid (Asp or D) to Asparagine (Asn or N) | - | 670 | GAC | AAC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | USA, Portugal | American | rare, only found in a homozygous patient from the USA. | Another mutation at the same position is: p.Asp224Val | Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosis 2008; 196: 633-642. |
| p.Asp227Glu (D206E) | Exon 4 | 227 (old: 206) | Aspartic Acid (D) to Glutamic Acid (E) | Afrikaner-1, Maine | 681 | GAC | GAA | 2B; delayed transport of receptor from endoplasmic reticulum to cell surface; 5-15% activity | The Netherlands, Germany, UK, Ireland, Belgium, Surinam, Greece, Norway, USA, South Africa, New Zealand, Japan, Czech Republic, Uruguay, Taiwan, Poland | Dutch, South African, Iran | 141 carriers identified in the Netherlands (status 06-03-2024) | This variant is the result of two different nucleotide changes at position c.681: C to A is the most frequent (74%) and …This variant is the result of two different nucleotide changes at position c.681: C to A is the most frequent (74%) and C to G is seen less frequently (26%) in our collection. p.Asp227Glu is also one of the 4 Afrikaner founder mutations.In Afrikaners p.Asp227Glu is always caused by the C to G variant. | The genetic spectrum of familial hypercholesterolemia in south-eastern Poland. Sharifi M et al. Metabolism 2016; 65(3): …The genetic spectrum of familial hypercholesterolemia in south-eastern Poland. Sharifi M et al. Metabolism 2016; 65(3): 48-53.An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskova et al. Atherosclerosis 2011; 216: 139-145. Update of Japanese common LDLR gene mutations and their phenotypes: Mild type mutation L547V might predominate in the Japanese population. Yasuko Miyake et al. Atherosclerosis 2009; 203: 153-160. Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I et al. Atherosclerosis. 2007; 194(1): 102-111. Identification and characterization of novel low-density lipoprotein receptor mutations of familial hypercholesterolaemia patients in Taiwan. Charng MJ et al. Eur J Clin Invest 2006; 36: 866-874. Genetic screening protocol for familial hypercholesterolemia which includes splicing defects gives an improved mutation detection rate. Graham CA et al. Atherosclerosis 2005; 182: 331-340. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie AD et al. Atherosclerosis Supplements 2004; 5: 13-15 The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW et al. Hum Genet. 2001; 109(6): 602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE et al. Atherosclerosis. 2001; 154(1):243-246. Founder mutations in the LDL receptor gene contribute significantly to the familial hypercholesterolemia phenotype in the indigenous South African population of mixed ancestry. Loubser O et al. Clin Genet. 1999; 55(5): 340-345. Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia. Day IN et al. Hum Mutat. 1997; 10(2): 116-127. Phenotypic expression and frequency of familial defective apolipoprotein B-100 in Belgian hypercholesterolemics. Kotze MJ et al. Atherosclerosis. 1994; 111(2): 217-225. Identification of recurrent and novel mutations in exon 4 of the LDL receptor gene in patients with familial hypercholesterolemia in the United Kingdom. Gudnason V et al. Arterioscler Thromb. 1993; 13(1): 56-63. Identification of the serine-156 to leucine mutation in the low-density lipoprotein receptor in a German family with familial hypercholesterolemia. Schuster H et al. Clin Investig. 1993; 71(2): 172-175 Two common low density lipoprotein receptor gene mutations cause familial hypercholesterolemia in Afrikaners. Leitersdorf E et al. J Clin Invest. 1989; 84(3): 954-961. |
| p.Glu228Lys (E207K) | Exon 4 | 228 (207 old) | Glutamic Acid (E) to Lysine (K) | French-Canadian-3, Modena | 682 | GAG | AAG | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface; residual activity: <2% | French-Canada, Italy, Mexico, France, China, Taiwan, Korea, South Africa, The Netherlands, New Zealand, Malaysia, Portugal, Japan, Czech Republic, Brazil | Dutch, South African, Chinese, Brasilian, Pakistan | frequent; 5% of all mutations (1020 carriers; status 16-05-2024) | Other mutations at the same position are: p.Glu228* (Korean, American, German, Dutch, New Zealand, Russian), p.Glu228Gln (Ashkenazi Jewish) and p.Glu228Gly (Dutch) | Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, d…Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, de Souza Silva PR, Turolla L, Gagliardi AC, Marsiglia JD, Chacra AP, Miname MH, Rocha VZ, Filho WS, Krieger JE, Pereira AC. Atherosclerosis. 2014;238(1):101-107.An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskova, Lenka Kopeckova, Eva Jansova et al. Atherosclerosis 2011;216:139-145. Update of Japanese common LDLR gene mutations and their phenotypes: Mild type mutation L547V might predominate in the Japanese population. Yasuko Miyake,Taku Yamamura, Naohiko Sakai, Toshiyuki Miyata, Yoshihiro Kokubo, Akira Yamamoto. Atherosclerosis 2009;203:153-160. Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosis 2008; 196: 633-642. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie AD, Scott RS, George PM. Atherosclerosis Supplements 2004; 5: 13-15 Novel and recurrent mutations of the LDL receptor gene in Korean patients with familial hypercholesterolemia. Kim JH, Choi HK, Lee H, Park HY, Kim JH, Kim JW, Kim HJ, Lee ST. Mol Cells. 2004; 18: 63-70. Identification and characterization of LDL receptor gene mutations in hyperlipidemic Chinese. Chang JH, Pan JP, Tai DY, Huang AC, Li PH, Ho HL, Hsieh HL, Chou SC, Lin WL, Lo E, Chang CY, Tseng J, Su MT, Lee-Chen GJ. J Lipid Res. 2003; 44: 1850-1858. The molecular basis of familial hypercholesterolemia in The Netherlands.Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001 Jan;154(1):243-246. Clinical expression of familial hypercholesterolemia in clusters of mutations of the LDL receptor gene that cause a receptor-defective or receptor-negative phenotype. Bertolini S, Cantafora A, Averna M, Cortese C, Motti C, Martini S, Pes G, Postiglione A, Stefanutti C, Blotta I, Pisciotta L, Rolleri M, Langheim S, Ghisellini M, Rabbone I, Calandra S. Arterioscler Thromb Vasc Biol. 2000; 20: E41-52. Contribution of receptor negative versus receptor defective mutations in the LDL-receptor gene to angiographically assessed coronary artery disease among young (25-49 years) versus middle-aged (50-64 years) men.Gaudet D, Vohl MC, Couture P, Moorjani S, Tremblay G, Perron P, Gagne C, Despres JP. Atherosclerosis. 1999 Mar;143(1):153-161. Mutations in the low-density lipoprotein receptor gene in Chinese familial hypercholesterolemia patients. Mak YT, Pang CP, Tomlinson B, Zhang J, Chan YS, Mak TW, Masarei JR. Arterioscler Thromb Vasc Biol. 1998 Oct;18(10):1600-1605. Phenotypic variation in heterozygous familial hypercholesterolemia: a comparison of Chinese patients with the same or similar mutations in the LDL receptor gene in China or Canada. Pimstone SN, Sun XM, du Souich C, Frohlich JJ, Hayden MR, Soutar AK. Arterioscler Thromb Vasc Biol. 1998; 18: 309-315. Differences in the phenotype between children with familial defective apolipoprotein B-100 and familial hypercholesterolemia. Pimstone SN, Defesche JC, Clee SM, Bakker HD, Hayden MR, Kastelein JJ. Arterioscler Thromb Vasc Biol. 1997 May;17(5):826-833. CpG hotspot mutations at the LDL receptor locus are a frequent cause of familial hypercholesterolaemia among South African Indians Kotze MJ, Loubser O, Thiart R, de Villiers JN, Langenhoven E, Theart L, Steyn K, Marais AD, Raal FJ. Clin Genet. 1997; 51: 394-398. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1: 445-466. Common low-density lipoprotein receptor mutations in the French Canadian population. Leitersdorf E, Tobin EJ, Davignon J, Hobbs HH. J Clin Invest. 1990; 85:1014-1023. |
| p.Glu228* (E207X) | Exon 4 | 228 (old: 207) | Glutamic Acid (Glu or E) to Stop (* or X) | - | 682 | GAG | TAG | 1:null allele; no protein synthesized from this allel | Korea, USA, Germany, The Netherlands, Norway, New Zealand, Russia, UK, China | Dutch, British | 16 cases identified in The Netherlands (status 23-11-2023) | Other variantys at the same position are: p.Glu228Lys (general) p.Glu228Gly (Dutch)and and p.Glu228Gln (Ashkenazi Jewish) | Genetic identification of familial hypercholesterolemia within a single U.S. health care system. Abul-Husn NS et al. Sci…Genetic identification of familial hypercholesterolemia within a single U.S. health care system. Abul-Husn NS et al. Science 2016;354(6319):aaf7000. doi: 10.1126/science.aaf7000.Mutation detection in Chinese patients with familial hypercholesterolemia. Du R et al. Springerplus. 2016;5(1):2095. Clinical features of familial hypercholesterolemia in Korea: Predictors of pathogenic mutations and coronary artery disease – A study supported by the Korean Society of Lipidology and Atherosclerosis. Shin DG et al. Atherosclerosis. 2015;243(1):53-58. Genetic testing of Korean familial hypercholesterolemia using whole-exome sequencing. Han SM ey al. PLoS One. 2015;10(5):e0126706. Spectrum of mutations and phenotypic expression in patients with autosomal dominant hypercholesterolemia identified in Italy. Bertolini S et al. Atherosclerosis. 2013;227(2):342-348. The use of next-generation sequencing in clinical diagnosis of familial hypercholesterolemia.Vandrovcova J et al. Genet Med. 2013;15(12):948-957. Use of targeted exome sequencing as a diagnostic tool for Familial Hypercholesterolaemia. Futema M et al. J Med Genet. 2012;49(10):644-649. An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. DuÅ¡ková L, KopeÄková L et al. Atherosclerosis. 2011;216(1):139-145. Mutation screening in patients for familial hypercholesterolaemia (ADH). Taylor A, Patel K, Tsedeke J, Humphries SE, Norbury G. Clin Genet. 2010;77(1):97-99. Nonsense-mediated decay of human LDL receptor mRNA. Holla ØL, Kulseth MA, Berge KE, Leren TP, Ranheim T. Scand J Clin Lab Invest. 2009;69(3):409-417. Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I et al. Atherosclerosis. 2007;194(1):102-111. Multiplex ARMS analysis to detect 13 common mutations in familial hypercholesterolaemia. Taylor A et al. Clin Genet. 2007;71(6):561-568. Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. Mutations found in the low density lipoprotein receptor gene in Russia. Zakharova F Met al. BMC Med Genet. 2005;6 :6 Novel and recurrent mutations of the LDL receptor gene in Korean patients with familial hypercholesterolemia. Kim JH, et al. Mol Cells. 2004; 18:63-70. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie AD, Scott RS, George PM. Atherosclerosis Supplements 2004; 5: 1315 Use of denaturing HPLC to provide efficient detection of mutations causing familial hypercholesterolemia. Bodamer OA et al. Clin Chem. 2002; 48: 1913-1918. Identification of recurrent and novel mutations in the LDL receptor gene in German patients with familial hypercholesterolemia. Nauck MS et al. Hum Mutat. 2001;18:165-166. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP et al. Clin Genet. 2000 Feb;57(2):116-124. Comparison of the genetic defect with LDL-receptor activity in cultured cells from patients with a clinical diagnosis of heterozygous familial hypercholesterolemia. The Familial Hypercholesterolaemia Regression Study Group. Sun XM, Patel DD, Knight BL, Soutar AK. Arterioscler Thromb Vasc Biol. 1997;17(11):3092-3101. Screening for mutations in exon 4 of the LDL receptor gene in a German population with severe hypercholesterolemia. Giesel J, Holzem G, Oette K. Hum Genet. 1995;96(3):301-304. Familial hypercholesterolemia in China. Identification of mutations in the LDL-receptor gene that result in a receptor-negative phenotype. Sun XM et al. Arterioscler Thromb. 1994;14(1):85-94. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1(6):445-66. |
| p.Glu240Lys (E219K) | Exon 5 | 240 (old: 219) | Glutamic Acid (Glu or E) to Lysine (Lys or K) | FH-Charlotte | 718 | GAA | AAA | 2A: blocked transport of receptor from endoplasmatic reticulum to Golgi complex | The Netherlands, USA, New Zealand | Indonesian/Chinese | rare, one family, 2 carriers (status 21-08-2020) | Another mutation at the same position is: p.Glu240* (Dutch) | Targeted genetic testing for familial hypercholesterolemia using next generation sequencing: a population-based study. N…Targeted genetic testing for familial hypercholesterolemia using next generation sequencing: a population-based study. Norsworthy PJ, Vandrovcova J, Thomas ERA et al. BMC Medical Genetics 2014;15:70-76.Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie AD, Scott RS, George PM. Atherosclerosis Supplements 2004; 5: 13-15 Evidence that familial hypercholesterolemia mutations of the LDL receptor cause limited local misfolding in an LDL-A module pair. North CL, Blacklow SC. Biochemistry. 2000; 39:13127-13135. Solution structure of the sixth LDL-A module of the LDL receptor. North CL, Blacklow SC. Biochemistry. 2000;39:2564-2571. |
| p.Glu240* (E219X) | Exon 5 | 240 (old: 219) | Glutamic Acid (Glu or E) to Stop (* or X) | - | 718 | GAA | TAA | 1:null allele; no protein synthesized from this allele | The Netherlands | Dutch, of Oriental origin | rare, 1 family (3 patients) in the Netherlands (October 2002) | Another mutation at the same position is p.Glu240Lys | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| c.340_344del; p.Phe114Leufs*14 | Exon 4 | NA | Deletion of 5 basepairs, causes a stop codon, no protein synthesized. | FH-Izmir-1 | 340-344 | - | - | 1:null allele; no protein synthesized from this allele | Turkey | Turkish | rare, 2 patients known (Februay 2003) | This mutation is found in a (at that time 2 years old) Turkish, homozygous FH-patient that inherited 340del5bp from her father. The other mutation in this patient was H562Y in exon 12. | not described in literature |
| c.518delG; p.Cys173Serfs*33 | Exon 4 | NA | deletion causes frameshift and a stop at amino acid position 152 | - | 518 | - | - | 1:null allele; no protein synthesized from this allele | The Netherlands, Spain | Dutch, Spanish | 698 cases known (status 23-05-2023) including one case from Spain identified during the course of a clinical trial | - | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-15.Mutation analysis in 36 unrelated Spanish subjects with familial hypercholesterolemia: identification of 3 novel mutations in the LDL receptor gene. Mozas P, Cenarro A, Civeira F, Castillo S, Ros E, Pocovi M. Hum Mutat. 2000 May;15(5):483-484. |
| p.(Cys216*) | Exon 4 | 216 | deletion causes frameshift and a stop (*) at amino acid position Cys216 | - | 648-649 | - | - | 1:null allele; no protein synthesized from this allele | The Netherlands | Dutch | 43 patients identified (status 08-09-2023) | - | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615.Mutations in the low density lipoprotein receptor gene of familial hypercholesterolemic patients detected by denaturing gradient gel electrophoresis and direct sequencing.Lombardi P, Sijbrands EJ, van de Giessen K, Smelt AH, Kastelein JJ, Frants RR, Havekes LM. J Lipid Res. 1995 Apr;36(4):860-867. |
| c.660delC; p.Asp221Thrfs*44 | Exon 4 | NA | deletion causes frameshift and premature stop codon at Met265 | - | 660 | - | - | 1:null allele; no protein synthesized from this allele | The Netherlands, Germany, Canada, New-Zealand, Malaysia, Surinam | Dutch, Surinam, Malay, Indonesian, Hungarian/Indonesian, UK | 71 cases known, including 2 true homozygotes (status 06-05-2024) | On nucleotide position 657 to 660 there are 4 C’s present. One of them is deleted. The 3 remaining C’s shift one positio…On nucleotide position 657 to 660 there are 4 C’s present. One of them is deleted. The 3 remaining C’s shift one position to the left, thereby changing the codon in which the last C is present. This is the reason to denominate this mutation as 660delC. On June 15, 2004 we identified a 7-year old Malaysian girl that was homozygous for this mutation. Both parents were carrier and in this family there were another 4 heterozygous and 3 unaffected sibs.This mutation has also been found by a German group as the 657delC mutation. But because it can not be established which of the 4 C’s is deleted, it must be identical to 660delC. | Risk of Premature Atherosclerotic Disease in Patients With Monogenic Versus Polygenic Familial Hypercholesterolemia. Tri…Risk of Premature Atherosclerotic Disease in Patients With Monogenic Versus Polygenic Familial Hypercholesterolemia. Trinder M et al. J Am Coll Cardiol. 2019;74(4):512-522.Multiplex ARMS analysis to detect 13 common mutations in familial hypercholesterolaemia. Taylor A et al. Clin Genet. 2007;71(6):561-568. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie AD, Scott RS, George PM. Atheroscler Suppl. 2004;5(5):13-15. Identification of recurrent and novel mutations in the LDL receptor gene in German patients with familial hypercholesterolemia. Nauck MS et al. Hum Mutat 2001;18:165-166. The molecular basis of Familial Hypercholesterolemia in the Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Eight novel LDL receptor gene mutations among patients under LDL apheresis in Dresden and Leipzig. Bochmann H et al. Hum Mutat. 2001;17(1):76-77. |
| c.662_681dup; p.Glu228Thrfs*44 | Exon 4 | 228 | A duplication of 7 amino acids ( 200-206) at amino acid position 228 (duplication D-C-K-D-K-S-D) | FH-Tulsa-1 | after 681 | duplication of 21 basepairs prior | 681, inserted after 681: GACTGCAAGGACAAATCTGAC | 1:null allele; no protein synthesized from this allele (due to unstable mRNA) | The Netherlands, USA | Dutch | rare, 2 patients known (July 2008) | - | Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Muta…Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1: 445-466.Characterization of mutations in the low density lipoprotein (LDL)-receptor gene in patients with homozygous familial hypercholesterolemia, and frequency of these mutations in FH patients in the United Kingdom. Webb JC, Sun XM, McCarthy SN, Neuwirth C, Thompson GR, Knight BL, Soutar AK. Lipid Res. 1996;37:368-381. Identification of recurrent and novel mutations in the LDL receptor gene in Japanese familial hypercholesterolemia. Mutation in brief no. 248. Online. Hattori H, Nagano M, Iwata F, Homma Y, Egashira T, Okada T. Hum Mutat. 1999;14:87. Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| p.Cys236Arg (C215R) | Exon 5 | 236 (old: 215) | Cysteine (Cys or C) to Arginine (Arg or R) | - | 706 | TGT | CGT | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands | Dutch | rare, 2 index cases known | - | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615 |
| p.Cys248Gly (C227G) | Exon 5 | 248 (old: 227) | Cysteine (Cys or C) to Glycine (Gly or G) | - | 742 | TGC | GGC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands | Dutch, Belgian | 8 cases identified (status 03-04-2023) | - | Functionality of sequence variants in the genes coding for the low-density lipoprotein receptor and apolipoprotein B in …Functionality of sequence variants in the genes coding for the low-density lipoprotein receptor and apolipoprotein B in individuals with inherited hypercholesterolemia. Huijgen R et al. Hum Mutat. 2010;31(6):752-60.The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet. 2001 Dec;109(6):602-615. |
| p.Arg253Trp (R232W) | Exon 5 | 253 (old: 232) | Arginine (Arg or R) to Tryptophan (trp or W) | - | 757 | CGG | TGG | none; this variant is non-pathogenic | Germany, Austria, South Africa, The Netherlands | Dutch | frequent; 108 carriers in the Netherlands | Our family studies revealed that this variant is not associated with hypercholesterolemia. In 43 mutation carriers mean …Our family studies revealed that this variant is not associated with hypercholesterolemia. In 43 mutation carriers mean total cholesterol was 5.07, LDL-cholesterol 3.12, HDL-cholesterol 1.29 and triglycerides 1.46 mmol/l. In 62 family members that did not have R232W, mean total cholesterol was 5.16, LDL-cholesterol 3.20, HDL-cholesterol 1.16 and triglycerides 1.73 mmol/l. | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109:602-615.Predominance of a 6 bp deletion in exon 2 of the LDL receptor gene in Africans with familial hypercholesterolaemia. Thiart R, Scholtz CL, Vergotine J, Hoogendijk CF, de Villiers JN, Nissen H, Brusgaard K, Gaffney D, Hoffs MS, Vermaak WJ, Kotze MJ. J Med Genet. 2000;37:514-519. |
| p.Cys255Arg (C234R) | Exon 5 | 255 (234 old) | Cysteine (C or Cys) to Arginine (R or Arg) | - | 763 | TGT | CGT | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands | Dutch | 163 carriers in the Netherlands (status 16-05-2024) | At the same position the p.Cys255Gly and p.Cys255Ser variants are also known. On June 25, 2013 we discovered a double heterozygote: p.Cys255Arg in LDLR and p.Arg3558Cys in APOB. | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109:602-615.Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet. 2000;57(2):116-124. |
| p.Arg257Trp (R236W) | Exon 5 | 257 (236 old) | Arginine (R) to Tryptophan (W) | - | 769 | CGG | TGG | 2B; partial blockage of transport of LDL receptor from endoplasmatic reticulum to Golgi complex. | The Netherlands, Germany, Brazil, China, Taiwan, Malaysia, Chile, Spain, Brazil, Aruba | Malaysia, Chile, Spain, China, Surinam, Aruba, Malaysia | 18 cases (status 22-04-2024) | This variant is found in 5 double heterozygotes from one family in the Netherlands and in 3 patients from Malaysia. Thes…This variant is found in 5 double heterozygotes from one family in the Netherlands and in 3 patients from Malaysia. These 7 patients have another variant (p.Asp589Asn in exon 12) on the same allele and all patients are of Chinese origin. The combination of these variants on the same allele is not described in literature.On Sept. 9, 2010 we identified this variant in 2 patients from Chile and on May 9, 2014 in a patient of Spanish origin living in the Netherlands. On May 12, 2016 we identified p.Arg257Trp in a monozygotic twin from Aruba with p.Gly373Asp on the other allele. Finally, on Oct. 14 we identified a this variant in a lady living in the Netherlands. In December 2022 we found the combination p.Arg257Trp/p.Asp589Asn in a mother and daughter from Surinam. In Sept. 2023 we identified another patient from Aruba with p.Arg257Trp and p.Gly373Asp on the other allele. At the same position the p.Arg257Pro variant (Dutch) is known. | Targeted Genetic Analysis in a Chinese Cohort of 208 Patients Related to Familial Hypercholesterolemia. Wang H, Yang H, …Targeted Genetic Analysis in a Chinese Cohort of 208 Patients Related to Familial Hypercholesterolemia. Wang H, Yang H, Liu Z et al. J Atheroscler Thromb. 2020;27(12):1288-1298.Genetic variations in familial hypercholesterolemia and cascade screening in East Asians. Chan ML, Cheung CL, Lee AC et al.Mol Genet Genomic Med. 2019;7(2):e00520. Genetic basis of index patients with familial hypercholesterolemia in Chinese population: mutation spectrum and genotype-phenotype correlation. Sun D, Zhou BY, Li S et al. Lipids Health Dis. 2018;17(1):252. Spectrum of mutations in index patients with familial hypercholesterolemia in Singapore: Single center study. Pek SLT, Dissanayake S, Fong JCW et al. Atherosclerosis 2018;269:106-116. Clinical features of familial hypercholesterolemia in Korea: Predictors of pathogenic mutations and coronary artery disease – A study supported by the Korean Society of Lipidology and Atherosclerosis. Shin DG. et al. Atherosclerosis. 2015;243(1):53-58. Exome-wide association analysis reveals novel coding sequence variants associated with lipid traits in Chinese. Tang CS, Zhang H, Cheung CY et al. Nat Commun. 2015;6:10206. Genetic testing of Korean familial hypercholesterolemia using whole-exome sequencing. Han SM, Hwang B, Park TG et al. PLoS One. 2015;10(5):e0126706. Activity-associated effect of LDL receptor missense variants located in the cysteine-rich repeats. Etxebarria A, Benito-Vicente A, Stef M et al. Atherosclerosis 2015;238(2):304-312. Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects. Jannes CE et al. Atherosclerosis. 2014;238(1):101-107. Detection of mutations and large rearrangements of the low-density lipoprotein receptor gene in Taiwanese patients with familial hypercholesterolemia. Chiou KR. et al. Am J Cardiol. 2010;105(12):1752-1758. Genetic diagnosis of familial hypercholesterolemia using a DNA-array based platform. Alonso R, Defesche JC, Tejedor D et al. Clin Biochem. 2009;42(9):899-903. Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. Molecular basis of familial hypercholesterolemia in Brazil: Identification of seven novel LDLR gene mutations. Salazar LA. et al. Hum Mutat 2002; 19:462-463. Identification of recurrent and novel mutations in the LDL receptor gene in German patients with familial hypercholesterolemia. Nauck MS. et al. Hum Mutat 2001; 18: 165-166. |
| p.Asp266Glu (D245E) | Exon 5 | 266 (245 old) | Aspartic Acid (D) to Glutamic Acid (E) | Cincinnati-1 | 798 | GAT | GAA | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, UK, Germany, Austria, Norway, Czech Republic, USA | Dutch, German, American | 81 patients in the Netherlands (status 21-07-2022) | other mutations at the same position are: p.Asp245Gly (Japan), p.Asp266Asn (Dutch, Japan), p.Asp266Tyr (German, Turkish) and p.Asp266His (Dutch, Chinese) | An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lu…An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskov, Lenka Kopeckov, Eva Jansov et al. Atherosclerosis 2011;216:139-145.The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109:602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis. 2001;154:243-246. Evidence that familial hypercholesterolemia mutations of the LDL receptor cause limited local misfolding in an LDL-A module pair. North CL, Blacklow SC. Biochemistry. 2000; 39: 13127-13135. Solution structure of the sixth LDL-A module of the LDL receptor. North CL, Blacklow SC. Biochemistry. 2000; 39: 2564-2571. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1:445-466 |
| p.Asp266Asn (D245N) | Exon 5 | 266 (old: 245) | Aspartic Acid (Asp or D) to Asparagine (Asn or N) | FH-Tozeur | 796 | GAT | AAT | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, Norway, Japan, Czech Republic, Tunesia | Dutch, Turkish | 38 cases in the Netherlands (status 23-05-2023) | other mutations at the same position are: p.Asp266Glu (general European, American), p.Asp266Gly (Japan), p.Asp266Tyr (German, Turkish) and p.Asp266His (Dutch, Chinese) | An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lu…An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskov, Lenka Kopeckov, Eva Jansov et al. Atherosclerosis 2011;216:139-145.The relationship of molecular genetic to clinical diagnosis of familial hypercholesterolemia in a Danish population. Damgaard D et al. Atherosclerosis 2005;180(1):155-160). Mutations in Japanese subjects with primary hyperlipidemia. Results from the Research Committee of the Ministry of Health and Welfare of Japan since 1996 -. Maruyama T, Yamashita S, Matsuzawa Y et al. J Atheroscler and Thromb. 2004;11(3):131-145. YS127S (FH-Kairouan) and D245N (FH-Tozeur) mutations in the LDL receptor gene in Tunisian families with familial hypercholesterolaemia. Slimane MN. et al. J Med Genet. 2002;39(11):e74) Molecular genetic analysis of familial hypercholesterolemia: spectrum and regional difference of LDL receptor gene mutations in Japanese population. Yu W, nohara A, Higashikata T, Lu H, Inazu A, Mabuchi H. Atherosclerosis 2002;165:335-342. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109:602-615 |
| p.Glu267Asp (E246D) | Exon 5 | 267 (old: 246) | Glutamic Acid (Glu or E) to Aspartic Acid (Asn or D) | - | 801 | GAA | GAT | 3, the mutation occured in the ApoB binding domain and interferes with binding to the LDL particle. | The Netherlands | Dutch (Italian?) | 41 patients known in the Netherlands (April 2018) | Another (Spanish) mutation at the same position is: p.Glu267Ala | not described in literature |
| p.Cys270Ser (C249S) | Exon 5 | 270 (old: 249) | Cysteine (Cyys or C) to Serine (Ser or S) | - | 808 | TGC | AGC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands | Dutch from Oriental ancestry | rare, 1 patient from Amsterdam (June 2004) | Other mutations at the same position are:Other mutations at the same position are:p.Cys270Tyr (USA, FH-Miami-2; found in our lab in an American homozygous patient of Greek descent) p.Cys270Arg (Czech Republic) p.Cys270* (The Netherlands, Russian) Amino acid position 249 is a so called hotspot for mutations, with 4 different mutations at the same spot. | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| c.796_800del; p.Asp266Serfs*5 | Exon 5 | NA | Deletion causes frameshift and a Stop at amino acid position 271 | - | 796-800 | - | - | 1:null allele; no protein synthesized from this allele | The Netherlands | Dutch | rare, 1 family in the Netherlands; 6 affected family members (status 11-12-2020) | - | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109:602-615. |
| c.814_817del; p.Asn272* | Exon 5 | NA | No LDL receptor is produced | - | 814 - 817 | - | - | 1:null allele; no protein synthesized from this allele | The Netherlands | Dutch | rare, 1 family with 3 affected family members (April 2011) | - | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| p.Glu277Lys (E256K) | Exon 6 | 277 (old: 256) | Glutamic Acid (Glu or E) to Lysine (Lys or K) | Walloon, Genoa-3 | 829 | GAG | AAG | none; this variant is non-pathogenic | Belgium, Sweden, Italy, Spain, Cuba, The Netherlands, Norway | Dutch, Turkish | 48 carriers known (Feb. 2008) | In Sweden a family is described with E256K and I402T on the same allele.In Sweden a family is described with E256K and I402T on the same allele.According to activity tests E256K is reported as not pathogenic (Mol Pathol 2000). We found that 20 carriers have an mean LDL of 5.24 mmol/l and 23 non-carriers have a mean LDl of 5.17 mmol/l. | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109:602-615.Clinical expression of familial hypercholesterolemia in clusters of mutations of the LDL receptor gene that cause a receptor-defective or receptor-negative phenotype. Bertolini S, Cantafora A, Averna M, Cortese C, Motti C, Martini S, Pes G, Postiglione A, Stefanutti C, Blotta I, Pisciotta L, Rolleri M, Langheim S, Ghisellini M, Rabbone I, Calandra S. Arterioscler Thromb Vasc Biol. 2000; 20: E41-E52. Mutation analysis in 36 unrelated Spanish subjects with familial hypercholesterolemia: identification of 3 novel mutations in the LDL receptor gene. Mozas P, Cenarro A, Civeira F, Castillo S, Ros E, Pocovi M. Hum Mutat. 2000; 15: 483-484. Expression of an LDL receptor allele with two different mutations (E256K and I402T). Ekstrom U, Abrahamson M, Sveger T, Sun XM, Soutar AK, Nilsson-Ehle P. Mol Pathol. 2000; 53: 31-36. High prevalence of a novel mutation in the exon 4 of the low-density lipoprotein receptor gene causing familial hypercholesterolemia in Belgium. Descamps O, Hondekijn JC, Van Acker P, Deslypere JP, Heller FR. Clin Genet 1997; 51: 303-308. Recurrent and novel LDL receptor gene mutations causing heterozygous familial hypercholesterolemia in La Habana. Pereira E, Ferreira R, Hermelin B, Thomas G, Bernard C, Bertrand V, Nassiff H, Mendez del Castillo D, Bereziat G, Benlian P. Hum Genet 1995; 96: 319-322. |
| p.Cys284Gly (C263G) | Exon 6 | 284 (old: 263) | Cysteine (Cys or C) to Glycine (Gly or G) | - | 850 | TGT | GGT | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands | Dutch | 6 patients identified (Feb. 2008) | Found for the first time in April 2003. In Norway and New Zealand the p.Cys284Ser variant is known. | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| p.Ser286Arg (S265R) | Exon 6 | 286 (old: 265) | Serine (Ser or S) to Arginine (Arg or R) | Greece-2 | 858 | AGC | AGA | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | UK, Austria, Greece, The Netherlands | Netherlands, Greece, Croatia, Eastern Europe (Bosnia, Kosovo, Serbia, Moldavia), Turkey | 145 patients in total (status 28-03-2024) | Also identified in a compound heterozygote with p.Asn564Asp on the other allele. | Development of a universal chemiluminometric genotyping method for high-throughput detection of 7 LDLR gene mutations in…Development of a universal chemiluminometric genotyping method for high-throughput detection of 7 LDLR gene mutations in Greek population. Glynou K, Laios E, Drogari E, Tsaoussis V. Clin Biochem. 2008;41:335-342.Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I, Toledo-Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Atherosclerosis. 2007;194(1):102-111. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis 2001; 154: 243-246. Analysis of low density lipoprotein receptor gene mutations and microsatellite haplotypes in Greek FH heterozygous children: six independent ancestors account for 60% of probands. Traeger-Synodinos J, Mavroidis N, Kanavakis E, Drogari E, Humphries SE, Day IN, Kattamis C, Matsaniotis N. Hum Genet 1998; 102(3): 343-347. Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia Day IN, Whittall RA, O’Dell SD, Haddad L, Bolla MK, Gudnason V, Humphries SE. Hum Mutat 1997;10(2): 116-127. |
| p.Glu288Lys (E267K) | Exon 6 | 288 (old: 267) | Glutamic Acid (E or Glu) to Lysine (K or Lys) | - | 862 | GAA | AAA | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, Germany, Portugal, Madeira, New Zealand, Spain, Italy | Dutch-Indonesian, Dutch-Spanish, Portugal, India, Sierra Leone | rare, 14 patients known in the Netherlands and 1 from Madeira (status 25-01-2024) | At the same position the variant p.Glu288* (Italian, Czech) is known | Diagnostic yield of sequencing familial hypercholesterolemia genes in individuals with primary hypercholesterolemia. Lam…Diagnostic yield of sequencing familial hypercholesterolemia genes in individuals with primary hypercholesterolemia. Lamiquiz-Moneo I et al. Rev Esp Cardiol (Engl Ed). 2021;74(8):664-673.Six years experience with LipidSeq: clinical and research learnings from a hybrid, targeted sequencing panel for dyslipidemias. Dron JS en al. BMC Med Genomics. 2020;13(1):23. Harmonizing Clinical Sequencing and Interpretation for the eMERGE III Network. eMERGE Consortium. Electronic address: agibbs@bcm.edu; eMERGE Consortium. Am J Hum Genet. 2019;105(3):588-605. Validation of LDLr Activity as a Tool to Improve Genetic Diagnosis of Familial Hypercholesterolemia: A Retrospective on Functional Characterization of LDLr Variants. Benito-Vicente A et al. Int J Mol Sci. 2018;19(6):1676. An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Dušková L et al. Atherosclerosis. 2011;216(1):139-145. Mutational analysis of a cohort with clinical diagnosis of familial hypercholesterolemia: considerations for genetic diagnosis improvement. Medeiros AM et al. Genetics in Medicine : Official Journal of the American College of Medical Genetics. 2016;18(4):316-324. Polygenic Versus Monogenic Causes of Hypercholesterolemia Ascertained Clinically. Wang J et al. Arterioscler Thromb Vasc Biol. 2016;36(12):2439-2445. Genetic diagnosis of familial hypercholesterolemia using a DNA-array based platform. Alonso R et al.Clin Biochem. 2009;42(9):899-903. Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosis 2008; 196: 633-642. Comparison of SSCP and DHPLC for the detection of LDLR mutations in a New Zealand cohort. Bunn CF et al. Hum Mutat. 2002;19(3):311. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie AD, Scott RS, George PM. Atherosclerosis Supplements 2004; 5: 13-15 The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Mutation analysis in 46 German families with familial hypercholesterolemia: identification of 8 new mutations.Ebhardt M et al. Hum Mutat. 1999;13(3):257. |
| p.Lys 294Glu (K273E) | Exon 6 | 294 (old: 273) | Lysine (Lys or K) to Glutamic Acid (Glu or E) | - | 880 | AAA | GAA | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands | Dutch | rare, 2 patients known in the Netherlands (Jan. 2013) | - | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615.Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet 2000; 57(2): 116-124. |
| p.Asp304Asn (D283N) | Exon 6 | 304 (old:283) | Aspartic Acid (D or Asp) to Asparagine (N or Asn) | Denver-2 | 910 | GAC | AAC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | Ireland, UK, The Netherlands, USA, South Africa, Malaysia, Czech Republic | Dutch, Malay, Surinamese, Curacao (Madeira) | rare, 21 patients known in the Netherlands; 1 family with 8 patients identified in Malaysia (status 04-04-2024) | on the same position the variants p.Asp304Val (Dutch), p.Asp304Glu (French, British) p.Asp304Tyr (French) and p.Asp304His (unknown origin) are known. | Mutational analysis and genotype-phenotype relation in familial hypercholesterolemia: The SAFEHEART registry. Bourbon M.…Mutational analysis and genotype-phenotype relation in familial hypercholesterolemia: The SAFEHEART registry. Bourbon M. et al. Atherosclerosis. 2017;262:8-13.An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskova, Lenka Kopeckova, Eva Jansova et al. Atherosclerosis 2011;216:139-145. Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I, Toledo-Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Atherosclerosis. 2007;194(1):102-111. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis 2001; 154: 243-246. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat 1992; 1: 445-466. |
| p.Trp305Cys (W284C) | Exon 6 | 305 (old: 284) | Tryptophan (Trp or W) to Cysteine (Vys or C) | - | 915 | TGG | TGC | 2A: blocked transport of receptor from endoplasmatic reticulum to Golgi complex | The Netherlands | Dutch | rare, 3 cases in the Netherlands (Oct. 2011) | - | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556. |
| p.Ser306Leu (S285L) | Exon 6 | 306 (285 old) | Serine (S) to Leucine (L) | Amsterdam | 917 | TCA | TTA | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface; activity 2-5% | The Netherlands, Germany, Denmark, Norway, South Africa, USA | Dutch | frequent, 4% of mutations in the Netherlands; 1226 carriers known (status 29-04-2024). | - | The clinical and molecular diversity of homozygous familial hyper-cholesterolemia in children: Results from the GeneTics…The clinical and molecular diversity of homozygous familial hyper-cholesterolemia in children: Results from the GeneTics of clinical homozygous hypercholesterolemia (GoTCHA) study. Luirink IK et al. J Clin Lipidol. 2019;13(2):272-278.Founder mutations in the Netherlands: geographical distribution of the most prevalent mutations in the low-density lipoprotein receptor and apolipoprotein B genes. Kusters DM et al. Neth Heart J. 2011;19(4):175-182. Functionality of sequence variants in the genes coding for the low-density lipoprotein receptor and apolipoprotein B in individuals with inherited hypercholesterolemia. Huijgen R et al. Hum Mutat. 2010;31(6):752-60. Molecular genetic analysis of 1053 Danish individuals with clinical signs of familial hypercholesterolemia. Brusgaard K et al. Clin Genet. 2006 Mar;69(3):277-283. Application of molecular genetics for diagnosing familial hyper-cholesterolemia in Norway: results from a family-based screening program. Leren TP et al.Semin Vasc Med. 2004;4(1):75-85. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Identification of recurrent and novel mutations in the LDL receptor gene in German patients with familial hypercholesterolemia. Nauck M et al. Hum Mutat. 2001;18(2):165-166. Spectrum of LDL receptor gene mutations in Denmark: implications for molecular diagnostic strategy in heterozygous familial hypercholesterolemia. Jensen HK et al. Atherosclerosis. 1999;146(2):337-344. Ten LDL receptor mutants explain one third of familial hypercholesterolemia in a German sample. Schuster H et al. Arterioscler Thromb Vasc Biol 1995;15: 2176-2180. Mutations in the low density lipoprotein receptor gene of familial hypercholesterolemic patients detected by denaturing gradient gel electrophoresis and direct sequencing. Lombardi P et al. J Lipid Res. 1995;36(4):860-867. Molecular genetics of the LDL receptor gene in familial hyper-cholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1(6):445-466. |
| p.Lys311Arg & p.Cys313Trp (K290R & C292W) | Exon 6 | 311 and 313 (old: 29 | Lysine (lys or K) to Arginine (Arg or R) AND Cysteine (Cys or C) to Tryptophan (Trp or W) | - | 932 and 939 | AAA | AGA (K290R) and TGC to TGG (C292W) | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, France, Belgium | Dutch, Suriname, Poland | 7 families known in the Netherlands; 33 carriers identified (status 08-02-2022) | We established that these mutations are located on the same allele in Dutch patients. p.Lys311Arg is reported as a separ…We established that these mutations are located on the same allele in Dutch patients. p.Lys311Arg is reported as a separate mutation in France but the rest of the gene was probably not explored.In New Zealand the p.Lys311Thr variant in known. | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche …Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556.The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis 2001; 154: 243-246. Impact of genetic defects on atherosclerosis in patients suspected of familial hypercholesterolaemia. Descamps OS, Gilbeau JP, Leysen X, Van Leuven F, Heller FR. Eur J Clin Invest 2001; 31: 958-965. |
| p.Cys313Tyr (C292Y) | Exon 6 | 313 (old: 292) | Cysteine (C or Cys) to Tyrosine (Y or Tyr) | - | 938 | TGC | TAC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | UK, The Netherlands, Sweden, New Zealand, Malaysia | Dutch, Malay. | rare 6 patients in the Netherlands and 5 from Malaysia including a true homozygous patient (status Jan. 2019) | At the same position the p.Cys313* (Dutch, Turkish, America, British) and p.Cys313Trp (Dutch-Surinam) variants are known. | Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor…Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I, Toledo-Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Atherosclerosis. 2007;194(1):102-111.Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie AD, Scott RS, George PM. Atherosclerosis Supplements 2004; 5: 13-15. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis 2001; 154: 243-246. Mutation analysis in a small cohort of New Zealand patients originating from the United Kingdom demonstrates genetic heterogeneity in familial hypercholesterolemia. Thiart R, Varret M, Lintott CJ, Scott RS, Loubser O, du Plessis L, de Villiers JN, Boileau C, Kotze MJ. Mol Cell Probes. 2000; 14(5): 299-304. |
| c.877delG; p.Asp293Thrfs*77 | Exon 6 | NA | deletion causes frameshift and a premature stop codon at amino acid position 348 | - | 877 | - | - | 1:null allele; no protein synthesized from this allele | The Netherlands | Dutch | 72 patients in the Netherlands (status 18-04-2024) | - | Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche …Update of the Molecular Basis of Familial Hypercholesterolemia in The Netherlands. Fouchier SW, Kastelein JJP, Defesche JC. Hum Mut 2005;26:550-556.The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Mutations in the low density lipoprotein receptor gene of familial hypercholesterolemic patients detected by denaturing gradient gel electrophoresis and direct sequencing.Lombardi P, Sijbrands EJ, van de Giessen K, Smelt AH, Kastelein JJ, Frants RR, Havekes LM. J Lipid Res. 1995; 36(4): 860-867. |
| p.Gly324Ser (G303S) | Exon 7 | 324 (303 old) | Glycine (G) to Serine (S) | - | 970 | GGC | AGC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, France, USA (African-American) | Dutch, African American, African, Surinam, Curacao | rare, 13 cases in the Netherlands; two Dutch, one from Surinam, two of probable African descent; one index case of African American descent. (status Aug. 2019)) | - | Intronic mutations outside of Alu-repeat-rich domains of the LDL receptor gene are a cause of familial hypercholesterole…Intronic mutations outside of Alu-repeat-rich domains of the LDL receptor gene are a cause of familial hypercholesterolemia. Amsellem S, Briffaut D, Carri A et al. Hum Genet. 2002;111(6):501-510. Epub 2002 Sep 13.The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Low density lipoprotein receptor mutations in a selected population of individuals with moderate hypercholesterolemia. Arca M, Jokinen E. Atherosclerosis 1998; 136: 187-194. |
| p.His327Tyr (H306Y) | Exon 7 | 327 (old: 306) | Histidine (His or H) to Tyrosine (Tyr or Y) | - | 979 | CAC | TAC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | UK, The Netherlands, Norway | Turkish, Dutch, Surinam, Pakistani, Afghan | rare, 1 Turkish, 2 Pakistani, 2 Afghan and 2 Surinam/Dutch families in the Netherlands; 26 patiënts in total (status 23-06-2023) | At the same position the p.His327Gln variant (Dutch) is known | Polygenic versus monogenic causes of hypercholesterolemia ascertained clinically. Wong J et al. Arterioscler Thromb Vasc…Polygenic versus monogenic causes of hypercholesterolemia ascertained clinically. Wong J et al. Arterioscler Thromb Vasc Biol. 2016;36(12):2439-2445.Inheritance pattern of familial hypercholesterolemia and markers of cardiovascular risk. Kusters DM et al. J Lipid Res. 2013;54(9):2543-2549. Antagonism of secreted PCSK9 increases low density lipoprotein receptor expression in HepG2 cells. McNutt MC et al. J Biol Chem. 2009284(16):10561-10570. Structural and biochemical characterization of the wild type PCSK9-EGF(AB) complex and natural familial hypercholesterolemia mutants. Bottomley et al. J Biol Chem. 2009;284(2):1313-1323. Application of molecular genetics for diagnosing familial hypercholesterolemia in Norway: results from a family-based screening program. Leren TP et al. Semin Vasc Med. 2004;4(1):75-85. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW et al. Hum Genet. 2001;109(6):602-615. Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia. Day IN et al. Hum Mutat. 1997;10(2):116-127. |
| p.Cys329Tyr (C308Y) | Exon 7 | 308 | Cysteine (C) to Tyrosine (Y) | - | 986 | TGC | TAC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, China, Malaysia, Taiwan, Philippines, Russia | Chinese, Dutch, Portugal, Cape Verde Islands | rare, 7 families in the Netherlands; 23 affected family members (status 06-05-2024) | On the same position the C308G variant (Ashkenazi Jewish) is also known. In April 2008 we identified a compound heterozygous patient from Taiwan with this mutation and with G457R on the other allele. | Familial hypercholesterolemia in St-Petersburg: the known and novel mutations found in the low density lipoprotein recep…Familial hypercholesterolemia in St-Petersburg: the known and novel mutations found in the low density lipoprotein receptor gene in Russia.Zakharova FM, Damgaard D, Mandelshtam MY, Golubkov VI, Nissen PH, Nilsen GG, Stenderup A, Lipovetsky BM, Konstantinov VO, Denisenko AD, Vasilyev VB, Faergeman O. BMC Med Genet. 2005;6 :6 Low density lipoprotein-receptor (LDL-R) gene mutations among Filipinos with familial hypercholesterolemia. Punzalan FE, Sy RG, Santos RS, Cutiongco EM, Gosiengfiao S, Fadriguilan E, George P, Laurie A.J Atheroscler Thromb. 2005;12(5):276-283. Identification and characterization of LDL receptor gene mutations in hyperlipidemic Chinese. Chang JH, Pan JP, Tai DY, Huang AC, Li PH, Ho HL, Hsieh HL, Chou SC, Lin WL, Lo E, Chang CY, Tseng J, Su MT, Lee-Chen GJ. J Lipid Res. 2003; 44: 1850-1858. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Low-density lipoprotein receptor gene mutations in a Southeast Asian population with Familial Hypercholesterolemia. Khoo KL, Van Acker P, Defesche JC, Tan H, Van de Kerkhof L, Heijnen-van Eijk SJ, Kastelein JJP, Deslypere JP. Clin Genet 2000; 58: 98-105. Mutations in the low-density lipoprotein receptor gene in Chinese familial hypercholesterolemia patients. Mak YT, Pang CP, Tomlinson B, Zhang J, Chan YS, Mak TW, Masarei JR. Arterioscler Thromb Vasc Biol. 1998;18:1600-1605. |
| p.Gly335Val (G314V) | Exon 7 | 335 (old: 314) | Glycine (G or Gly) to Valine (V or Val) | - | 1004 | GGC | GTC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands | Dutch | 129 patients known in the Netherlands (status 22-02-2024) | SIFT and PolyPhen predict this variant to be damaging. In New Zealand the p.Gly335Ser variant is known. | Genetic diagnosis of familial hypercholesterolemia using a DNA-array based platform. Alonso R, Defesche JC, Tejedor D, C…Genetic diagnosis of familial hypercholesterolemia using a DNA-array based platform. Alonso R, Defesche JC, Tejedor D, Castillo S, Stef M, Mata N, Gomez-Enterria P, Martinez-Faedo C, Forga L, Mata P. Clin Biochem. 2009;42(9):899-903.The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet. 2000;57(2):116-124. |
| p.Cys338Gly (C317G) | Exon 7 | 338 (old: 317) | Cysteine (Cys or C) to Glycine (GLy or G) | - | 1012 | TGC | GGC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands | Dutch | rare, 3 families in the Netherlands | Similar mutations are p.Cys338Arg and p.Cys338Ser (Japanese) and p.Cys338Tyr (Czech) | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615.Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet 2000; 57:116-124. |
| p.Asp342Asn (D321N) | Exon 7 | 342 (old: 321) | Aspartic Acid (Asp or D) to Asparagine (Asn or N) | - | 1024 | GAC | AAC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, UK | probably Spanish | rare, 3 patients in one family known in the Netherlands (Jan. 2008) | One patient is also carrier of p.Gly373Asn. PolyPhen and SIFT predict this variant to be benign. A similar variant is p.Asp342Tyr (Czech) | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615.Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia. Day IN, Whittall RA, O�Dell SD, Haddad L, Bolla MK, Gudnason V, Humphries SE. Hum Mutat 1997; 10:116-127. |
| p.Gly343Ser (G322S) | Exon 7 | 343 (322 old) | Glycine (G) to Serine (S) | FH-Picardie; FH-Syria | 1027 | GGC | AGC | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, France, Belgium, Austria, Syria, Israel, New Zealand, Portugal, Brazil, Uruguay | Dutch, New Zealand, Morocco, Italy | frequent: 590 patients in total, including 2 compound heterozygotes and one true homozygote (status 16-05-2024) | - | Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects. Jannes CE et al. Ather…Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects. Jannes CE et al. Atherosclerosis. 2014;238(1):101-107.Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosis 2008; 196: 633-642. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Genetic screening of patients with familial hypercholesterolaemia (FH): a New Zealand perspective. Laurie AD, Scott RS, George PM. Atherosclerosis Supplements 2004; 5: 13-15. Mutation analysis in a small cohort of New Zealand patients originating from the United Kingdom demonstrates genetic heterogeneity in familial hypercholesterolemia. Thiart R et al. Mol Cell Probes. 2000;14: 299-304. Molecular genetics of familial Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis 2001; 154: 243-246. Molecular genetics of hypercholesterolemia in Israel. Reshef A, Nissen H, Triger L et al. Hum Genet 1996; 98: 581-586. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hobbs HH, Brown MS, Goldstein JL. Hum Mutat. 1992;1(6):445-466. |
| p.Arg350* (R329X) | Exon 7 | 350 (old: 329) | Arginine (R) to Stop (* or X) | Fossum | 1048 | CGA | TGA | 1:null allele; no protein synthesized from this allele | The Netherlands, Germany, Belgium, UK, Poland, Norway, Korea, South Africa, Canada, China, Japan, Portugal, Czech Republic, Brazil | Dutch, Afghan | frequent: 241 patients in the Netherlands (status 25-10-2023) | The p.Arg350* variant is very frequent in de South of England. | Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, d…Familial hypercholesterolemia in Brazil: Cascade screening program, clinical and genetic aspects.Jannes CE, Santos RD, de Souza Silva PR, Turolla L, Gagliardi AC, Marsiglia JD, Chacra AP, Miname MH, Rocha VZ, Filho WS, Krieger JE, Pereira AC. Atherosclerosis. 2014;238(1):101-107.Analysis of the frequency and spectrum of mutations recognised to cause familial hypercholesterolaemia in routine clinical practice in a UK specialist hospital lipid clinic. Futema M, Whittall RA, Kiley A et al. Atherosclerosis 2013;229:161-168. An APEX-based genotyping microarray for the screening of 168 mutations associated with familial hypercholesterolemia. Lucie Duskov, Lenka Kopeckov, Eva Jansov et al. Atherosclerosis 2011;216:139-145. Familial hypercholesterolaemia in Portugal. M. Bourbon, A.C. Alves, A.M. Medeiros, S. Silva, A.K. Soutar. Atherosclerosis 2008; 196: 633-642. Genetic defects causing familial hypercholesterolaemia: identification of deletions and duplications in the LDL-receptor gene and summary of all mutations found in patients attending the Hammersmith Hospital Lipid Clinic. Tosi I, Toledo-Leiva P, Neuwirth C, Naoumova RP, Soutar AK. Atherosclerosis. 2007;194(1):102-111. Mutations in Japanese subjects with primary hyperlipidemia. Results from the Research Committee of the Ministry of Health and Welfare of Japan since 1996 -. Maruyama T, Yamashita S, Matsuzawa Y et al. J Atheroscler and Thromb. 2004;11(3):131-145. Molecular genetic analysis of familial hypercholesterolemia: spectrum and regional difference of LDL receptor gene mutations in Japanese population. Yu W, nohara A, Higashikata T, Lu H, Inazu A, Mabuchi H. Atherosclerosis 2002;165:335-342. The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615. Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis 2001; 154: 243-246. Spectrum of LDL receptor gene mutations in heterozygous familial hypercholesterolemia. Day IN, Whittall RA, O’Dell SD, Haddad L, Bolla MK, Gudnason V, Humphries SE. Hum Mutat 1997; 10:116-127. Contribution of receptor negative versus receptor defective mutations in the LDL-receptor gene to angiographically assessed coronary artery disease among young (25-49 years) versus middle-aged (50-64 years) men.Gaudet D, Vohl MC, Couture P, Moorjani S, Tremblay G, Perron P, Gagne C, Despres JP. Atherosclerosis. 1999 Mar;143(1):153-161. LDL-R and Apo-B-100 gene mutations in Polish familial hypercholesterolemias.Gorski B, Kubalska J, Naruszewicz M, Lubinski J. Hum Genet. 1998;102: 562-655. Molecular genetics of familial hypercholesterolaemia in Norway. Leren TP, Tonstad S, Gundersen KE, Bakken KS, Rodningen OK, Sundvold H, Ose L, Berg K. J Intern Med. 1997; 241:185-194. High prevalence of a novel mutation in the exon 4 of the low-density lipoprotein receptor gene causing familial hypercholesterolemia in Belgium. Descamps O, Hondekijn JC, Van Acker P, Deslypere JP, Heller FR. Clin Genet 1997; 51: 303-308. Mutations in the low density lipoprotein receptor gene of familial hypercholesterolemic patients detected by denaturing gradient gel electrophoresis and direct sequencing.Lombardi P, Sijbrands EJ, van de Giessen K, Smelt AH, Kastelein JJ, Frants RR, Havekes LM. J Lipid Res. 1995; 36: 860-867. |
| p.Cys352Trp (C331W) | Exon 7 | 352 (old: 331) | Cysteine (C or Cys) to Tryptophan (W or Trp) | Avellino-1 | 1056 | TGC | TGG | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, Italy, Belgium | Dutch | rare, 2 families with 8 cases in the Netherlands (August 2018) | on the same position C331Y (Mexico-2; in an American homozygote) and C331R (Dutch, Turkish, Austrian) have been found. | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615.Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis 2001; 154: 243-246. Clinical expression of familial hypercholesterolemia in clusters of mutations of the LDL receptor gene that cause a receptor-defective or receptor-negative phenotype. Bertolini S, Cantafora A, Averna M, Cortese C, Motti C, Martini S, Pes G, Postiglione A, Stefanutti C, Blotta I, Pisciotta L, Rolleri M, Langheim S, Ghisellini M, Rabbone I, Calandra S. Arterioscler Thromb Vasc Biol. 2000; 20: E41-52. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet 2000; 57:116-124. |
| p.Glu353Lys (E332K) | Exon 7 | 353 (332 old) | Glutamic Acid (E) to Lysine (K) | - | 1057 | GAA | AAA | 2B; delayed transport of receptor from endoplasmatic reticulum to cell surface | The Netherlands, Denmark | Dutch | 133 patients identified (status 18-04-2024) | Definite experimental proof that this variant is pathogenic is lacking.Definite experimental proof that this variant is pathogenic is lacking.A large proportion of carriers of this variant have normal cholesterol levels. Following the ClinVar recommendation, we down-graded this variant to a variant with unclear pathogenicity (class 3) as of 02-06-2022. | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615.The relationship of molecular genetic to clinical diagnosis of familial hypercholesterolemia in a Danish population. Damgaard D, Larsen ML, Nissen PH, Jensen JM, Jensen HK, Soerensen VR, Jensen LG, Faergeman O. Atherosclerosis 2005;180(1):155-160. |
| c.1061-8T>C | Intron 7 | NA | none; this variant is not functional | T to C | 1061-8 | T | C | none; this variant is not pathogenic | The Netherlands, Denmark, Spain, France | Dutch, Morocco | frequent; 191 heterozygous and 6 homozygous carriers identified in the Netherlands (Jan. 2010) | Software analyzing the effect of base pair changes on the generation or deletion of splice sites, does not give an indic…Software analyzing the effect of base pair changes on the generation or deletion of splice sites, does not give an indication that 1061-8T>C affects a splice site. We have found this variant in the heterozygous state in 185 individuals (Jan. 2010) of which many carry functional LDLR mutations. In 6 cases with a heterozygous FH phenotype we have found this variant in the homozygous state. This makes it unlikely that 1061-8T>C is a functional mutation. Remarkable is that of the 191 carriers, 162 also have the non-functional T705I-variant. | The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW…The molecular basis of familial hypercholesterolemia in The Netherlands. Fouchier SW, Defesche JC, Umans-Eckenhausen MAW, Kastelein JJP. Hum Genet 2001; 109: 602-615.Low-density lipoprotein receptor gene (LDLR) world-wide website in familial hypercholesterolaemia: update, new features and mutation analysis. Heath KE, Gahan M, Whittall RA, Humphries SE. Atherosclerosis 2001; 154: 243-246. Molecular genetic testing for familial hypercholesterolemia: spectrum of LDL receptor gene mutations in The Netherlands. Lombardi MP, Redeker EJ, Defesche JC, Kamerling SW, Trip MD, Mannens MM, Havekes LM, Kastelein JJ. Clin Genet 2000; 57:116-124. Mutation analysis in 36 unrelated Spanish subjects with familial hypercholesterolemia: identification of 3 novel mutations in the LDL receptor gene. Mozas P, Cenarro A, Civeira F, Castillo S, Ros E, Pocovi M. Hum Mutat. 2000; 15: 483-484. Spectrum of LDL receptor gene mutations in Denmark: implications for molecular diagnostic strategy in heterozygous familial hypercholesterolemia. Jensen HK, Jensen LG, Meinertz H, Hansen PS, Gregersen N, Faergeman O. Atherosclerosis 1999;146: 337-344. |
Explanation of the Data
- Source of data
- Amsterdam UMC, VUmc Campus, Department of Human Genetics, Genome Analysis Lab.
- Archive through 2016
- The data through 2016 comes from JoJo Genetics. That dataset has been frozen and will no longer be updated.
- Updated as of
- 2025. We aim to update the data annually.
- Questions and Owner Information
- Amsterdam UMC, Department of Human Genetics, Genome Analysis Lab, is the owner of the data. The LEEFH Foundation facilitates the presentation of this data on its website. Questions about the data should be directed to Linda Zuurbier, l.c.zuurbier@amsterdamumc.nl.
Abbreviations Used
- AA
- amino acid
- prot effect
- protein effect
- Freq
- frequency
- Add. info
- additional information
- REF
- references
- NA
- not applicable